ID: 1186157371

View in Genome Browser
Species Human (GRCh38)
Location X:6739485-6739507
Sequence TTGGTTGTCGCAACTGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186157369_1186157371 -5 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data
1186157366_1186157371 9 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data
1186157365_1186157371 14 Left 1186157365 X:6739448-6739470 CCTCTCCAGGGACATTTGGCCAT No data
Right 1186157371 X:6739485-6739507 TTGGTTGTCGCAACTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186157371 Original CRISPR TTGGTTGTCGCAACTGGAAA TGG Intergenic
No off target data available for this crispr