ID: 1186157373

View in Genome Browser
Species Human (GRCh38)
Location X:6739503-6739525
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186157366_1186157373 27 Left 1186157366 X:6739453-6739475 CCAGGGACATTTGGCCATGTCTG No data
Right 1186157373 X:6739503-6739525 AATGGCAGAGTGTGTGTGTCGGG No data
1186157369_1186157373 13 Left 1186157369 X:6739467-6739489 CCATGTCTGAGGACATTTTTGGT No data
Right 1186157373 X:6739503-6739525 AATGGCAGAGTGTGTGTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186157373 Original CRISPR AATGGCAGAGTGTGTGTGTC GGG Intergenic
No off target data available for this crispr