ID: 1186161166

View in Genome Browser
Species Human (GRCh38)
Location X:6778567-6778589
Sequence CCTCAAGTACTGCATCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186161166_1186161171 29 Left 1186161166 X:6778567-6778589 CCCTTTTGATGCAGTACTTGAGG No data
Right 1186161171 X:6778619-6778641 ATTTGCATCCAGAGTGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186161166 Original CRISPR CCTCAAGTACTGCATCAAAA GGG (reversed) Intergenic
No off target data available for this crispr