ID: 1186165900

View in Genome Browser
Species Human (GRCh38)
Location X:6825587-6825609
Sequence CAAGCTGGAGACTTAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186165900_1186165909 15 Left 1186165900 X:6825587-6825609 CCCACCTCTAAGTCTCCAGCTTG No data
Right 1186165909 X:6825625-6825647 AGCCACAGGAAGCTGAGTGTGGG No data
1186165900_1186165908 14 Left 1186165900 X:6825587-6825609 CCCACCTCTAAGTCTCCAGCTTG No data
Right 1186165908 X:6825624-6825646 GAGCCACAGGAAGCTGAGTGTGG No data
1186165900_1186165907 1 Left 1186165900 X:6825587-6825609 CCCACCTCTAAGTCTCCAGCTTG No data
Right 1186165907 X:6825611-6825633 AATGGAGAGAGGAGAGCCACAGG No data
1186165900_1186165910 16 Left 1186165900 X:6825587-6825609 CCCACCTCTAAGTCTCCAGCTTG No data
Right 1186165910 X:6825626-6825648 GCCACAGGAAGCTGAGTGTGGGG No data
1186165900_1186165905 -10 Left 1186165900 X:6825587-6825609 CCCACCTCTAAGTCTCCAGCTTG No data
Right 1186165905 X:6825600-6825622 CTCCAGCTTGGAATGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186165900 Original CRISPR CAAGCTGGAGACTTAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr