ID: 1186172578

View in Genome Browser
Species Human (GRCh38)
Location X:6892810-6892832
Sequence TGCTGTGCCCTCTCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186172578_1186172580 7 Left 1186172578 X:6892810-6892832 CCACCATGTGAGAGGGCACAGCA No data
Right 1186172580 X:6892840-6892862 AGCCCATCTGCAAGTCAGCAAGG No data
1186172578_1186172581 8 Left 1186172578 X:6892810-6892832 CCACCATGTGAGAGGGCACAGCA No data
Right 1186172581 X:6892841-6892863 GCCCATCTGCAAGTCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186172578 Original CRISPR TGCTGTGCCCTCTCACATGG TGG (reversed) Intergenic
No off target data available for this crispr