ID: 1186177372

View in Genome Browser
Species Human (GRCh38)
Location X:6938940-6938962
Sequence CAGATAATGGATAAGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186177366_1186177372 30 Left 1186177366 X:6938887-6938909 CCTAAGCACAATTATCCATTATG No data
Right 1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG No data
1186177370_1186177372 5 Left 1186177370 X:6938912-6938934 CCAGATAATTGGTAATAACTTAA No data
Right 1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG No data
1186177369_1186177372 6 Left 1186177369 X:6938911-6938933 CCCAGATAATTGGTAATAACTTA No data
Right 1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG No data
1186177368_1186177372 15 Left 1186177368 X:6938902-6938924 CCATTATGTCCCAGATAATTGGT No data
Right 1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186177372 Original CRISPR CAGATAATGGATAAGTATTC TGG Intergenic
No off target data available for this crispr