ID: 1186177811

View in Genome Browser
Species Human (GRCh38)
Location X:6943764-6943786
Sequence TTGGAAATGCAGCACCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186177811_1186177814 13 Left 1186177811 X:6943764-6943786 CCTAAATGGTGCTGCATTTCCAA No data
Right 1186177814 X:6943800-6943822 ATTGAACACACTGCCACTGGAGG No data
1186177811_1186177813 10 Left 1186177811 X:6943764-6943786 CCTAAATGGTGCTGCATTTCCAA No data
Right 1186177813 X:6943797-6943819 AGCATTGAACACACTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186177811 Original CRISPR TTGGAAATGCAGCACCATTT AGG (reversed) Intergenic
No off target data available for this crispr