ID: 1186187417

View in Genome Browser
Species Human (GRCh38)
Location X:7035132-7035154
Sequence ACTTCTATACAGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186187417_1186187421 12 Left 1186187417 X:7035132-7035154 CCACCCACCTTCTGTATAGAAGT No data
Right 1186187421 X:7035167-7035189 ATCAATGATTTTTATTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186187417 Original CRISPR ACTTCTATACAGAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr