ID: 1186188297

View in Genome Browser
Species Human (GRCh38)
Location X:7043123-7043145
Sequence TGTGAATGATCACCTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186188297_1186188299 -10 Left 1186188297 X:7043123-7043145 CCTGGGGCAGGTGATCATTCACA No data
Right 1186188299 X:7043136-7043158 ATCATTCACAGATGACATGAGGG No data
1186188297_1186188300 15 Left 1186188297 X:7043123-7043145 CCTGGGGCAGGTGATCATTCACA No data
Right 1186188300 X:7043161-7043183 TGCACAGCACGTGAGTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186188297 Original CRISPR TGTGAATGATCACCTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr