ID: 1186188299

View in Genome Browser
Species Human (GRCh38)
Location X:7043136-7043158
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186188297_1186188299 -10 Left 1186188297 X:7043123-7043145 CCTGGGGCAGGTGATCATTCACA No data
Right 1186188299 X:7043136-7043158 ATCATTCACAGATGACATGAGGG No data
1186188295_1186188299 2 Left 1186188295 X:7043111-7043133 CCTTCAAGAAGTCCTGGGGCAGG No data
Right 1186188299 X:7043136-7043158 ATCATTCACAGATGACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186188299 Original CRISPR ATCATTCACAGATGACATGA GGG Intergenic