ID: 1186188299 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:7043136-7043158 |
| Sequence | ATCATTCACAGATGACATGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186188297_1186188299 | -10 | Left | 1186188297 | X:7043123-7043145 | CCTGGGGCAGGTGATCATTCACA | No data | ||
| Right | 1186188299 | X:7043136-7043158 | ATCATTCACAGATGACATGAGGG | No data | ||||
| 1186188295_1186188299 | 2 | Left | 1186188295 | X:7043111-7043133 | CCTTCAAGAAGTCCTGGGGCAGG | No data | ||
| Right | 1186188299 | X:7043136-7043158 | ATCATTCACAGATGACATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186188299 | Original CRISPR | ATCATTCACAGATGACATGA GGG | Intergenic | ||