ID: 1186190454

View in Genome Browser
Species Human (GRCh38)
Location X:7062690-7062712
Sequence AGGTGGGTGGGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2217
Summary {0: 1, 1: 1, 2: 11, 3: 272, 4: 1932}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186190454 Original CRISPR AGGTGGGTGGGGAGGGAAGC TGG Intronic
Too many off-targets to display for this crispr