ID: 1186190651

View in Genome Browser
Species Human (GRCh38)
Location X:7064579-7064601
Sequence GGACCCTCTGGGCACCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186190651_1186190657 10 Left 1186190651 X:7064579-7064601 CCTGAGAGGTGCCCAGAGGGTCC 0: 1
1: 0
2: 1
3: 28
4: 208
Right 1186190657 X:7064612-7064634 CAACCTCTCCTGAGTCATGCTGG 0: 1
1: 1
2: 15
3: 215
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186190651 Original CRISPR GGACCCTCTGGGCACCTCTC AGG (reversed) Intronic
900297767 1:1960477-1960499 GGACCCTCTCAGCCCCTTTCAGG + Intronic
901448673 1:9323288-9323310 GGCTCCACTGGGCCCCTCTCTGG + Intronic
901637813 1:10678456-10678478 CGGCCCTGTGGGCACCTCCCTGG - Intronic
902748572 1:18490269-18490291 GGACCCTCTGGGTGCCTGCCTGG + Intergenic
903125457 1:21244527-21244549 GGACCCTCAGGGCTCCTGGCAGG + Intronic
903276628 1:22226093-22226115 GGCCCCTCTGGGAGCCTTTCAGG - Intergenic
903580451 1:24366761-24366783 GGCTGCTCTGGGCACCTCTCTGG - Intronic
904462149 1:30686493-30686515 GGACCCTCTGGGATCCTCCATGG + Intergenic
904675219 1:32195055-32195077 GGCCCCTCTGGCCTCCTCTCAGG - Exonic
905448445 1:38042612-38042634 GGGCCCTGGGGACACCTCTCTGG + Intergenic
906211714 1:44015928-44015950 GCCATCTCTGGGCACCTCTCAGG + Intronic
906537882 1:46561934-46561956 GGACTCTCTGTGAACCTCTCAGG + Intronic
908043503 1:60142515-60142537 GGAAAGTCTGGGCACCACTCTGG + Intergenic
908259012 1:62325273-62325295 GTGGCCTCTGGGCAGCTCTCAGG + Intergenic
908764772 1:67544565-67544587 GGAACCCCAGGCCACCTCTCAGG + Intergenic
909210971 1:72822829-72822851 GGACCCTCTGCAGACCTCTGGGG - Intergenic
910935489 1:92482837-92482859 GAACCCACTGGGAACCTCTTGGG - Intronic
910935693 1:92483674-92483696 GGGCCCTCTGCGCGCCTCCCTGG - Intronic
911830610 1:102546033-102546055 GGATGCTGTGGGCACCTCTCTGG + Intergenic
913084502 1:115424338-115424360 GCACCATCTGGGCACCTTCCAGG - Intergenic
914917150 1:151825871-151825893 GGACCCTGTCGTCACCCCTCTGG - Intronic
915705103 1:157836185-157836207 GGACCCTCTGAGCTCCTCTCAGG - Intronic
916422164 1:164647499-164647521 TGACCCCCTGGGCCCCTCCCAGG + Intronic
916562833 1:165948174-165948196 GGACCCTCTGGGCAGCTGCTGGG + Intergenic
920851459 1:209630811-209630833 TGACCCTCTGCGCACCACTCAGG + Intronic
922564860 1:226595139-226595161 CGGCCCCCTGGGGACCTCTCAGG - Intronic
922773338 1:228201760-228201782 GAATCCTCTGGGGACCTCACAGG + Intergenic
922823647 1:228502176-228502198 GAACCCTGTGGGCATCTCTTTGG - Intergenic
923259184 1:232250662-232250684 TGACCCTCTGGGAATCCCTCAGG + Intergenic
1062856753 10:783747-783769 TGACCCTCTGTCCACCTCCCAGG + Intergenic
1065490226 10:26275039-26275061 GGACCCTTGGGGCTTCTCTCAGG + Intronic
1065814174 10:29469769-29469791 GGACTCTCCGGGCACTTCCCGGG - Intronic
1067272539 10:44804658-44804680 TGACCTTCTGGTCACCTCTCTGG - Intergenic
1067741488 10:48898882-48898904 AGCTCCTGTGGGCACCTCTCTGG + Intronic
1069897712 10:71689281-71689303 AGAACCTCTGGGTACCACTCTGG + Intronic
1070848302 10:79541825-79541847 GGACCTTCTGGGCACGTGACTGG - Intergenic
1071676330 10:87659561-87659583 GGACGCTCTGGGACCCTCTGGGG + Intergenic
1072067255 10:91883300-91883322 TGACCCTCTGGGCAACACTCAGG - Intergenic
1074382956 10:112995154-112995176 GGAACCCCTGGGCTGCTCTCTGG + Intronic
1074451655 10:113564351-113564373 GTCCCCTCATGGCACCTCTCTGG + Intronic
1075633630 10:124016128-124016150 GGCCCCTCTGAGCACCCCTCAGG + Intronic
1076723823 10:132404342-132404364 GGAGCCTCTGGGCCTGTCTCTGG + Intronic
1076920836 10:133453993-133454015 GGACCATGAGGGCAGCTCTCTGG + Intergenic
1076978899 11:195027-195049 GGACCCTGTGTGTACCTCTGTGG - Intronic
1077319756 11:1935923-1935945 GGACCCCCTGGGGACAGCTCTGG - Intronic
1077444819 11:2586066-2586088 CCACCCTCTGGGCACCTCAGCGG - Intronic
1077497075 11:2891573-2891595 GGGCCCTCATGCCACCTCTCTGG - Intronic
1078087060 11:8240215-8240237 GGCCCCTCTGGGGAGCTCTGGGG - Intronic
1081702734 11:45162159-45162181 GGACCCTCTGGGTACCTAGAGGG + Intronic
1082782752 11:57300189-57300211 GGACCCTGTGGGCACTTACCAGG - Intronic
1083309280 11:61776205-61776227 GGACACCCTGGGTACCTCCCTGG - Intronic
1083678432 11:64340585-64340607 GACCCCTCTGGGCTCCTCACAGG + Exonic
1083694689 11:64434727-64434749 GGACCTACTGGCCACCTCTCAGG + Intergenic
1085058627 11:73424400-73424422 GGAACTTCTGGGCACCTGTGAGG - Intronic
1088848121 11:113684406-113684428 TGACCCTCTTGGAACATCTCAGG + Intergenic
1089587658 11:119520466-119520488 GGACCTTGTGGGAAACTCTCTGG + Intergenic
1089682978 11:120129778-120129800 GGACTCTCTGGGAAGCTCTGTGG - Intronic
1090207967 11:124896304-124896326 GGACCCCCCGGACACCTGTCAGG + Exonic
1090924943 11:131241263-131241285 GGATCCTCCGGGCAGCTCTCTGG - Intergenic
1096573897 12:52540753-52540775 GCACCCTCAGGACACCTCTGGGG - Intergenic
1099745284 12:86694820-86694842 AAAACCTCTGGGCAGCTCTCTGG + Intronic
1101399053 12:104372645-104372667 GGATCCTCTGAGCAGCTCTAGGG - Intergenic
1104755521 12:131266854-131266876 GGTCCCTGTGTCCACCTCTCAGG - Intergenic
1106570570 13:30923738-30923760 GGACACTCTGGGCAGCCCACAGG - Intronic
1108817751 13:54313003-54313025 GCACCATGTGGGCCCCTCTCTGG + Intergenic
1112955081 13:105047597-105047619 AGACCCTCTGTGCACATCTCTGG - Intergenic
1119174862 14:72561625-72561647 GGACTCTCCTGGCACCTCTATGG + Intronic
1121016468 14:90552271-90552293 GGACCTTCTGGGCACCAGGCAGG + Intronic
1121095961 14:91218162-91218184 AGGCCCTCTGGGCCCCTCTAGGG - Intronic
1121926167 14:97929260-97929282 GGACCCTCTGGACAGCTTTTTGG + Intronic
1122627695 14:103092584-103092606 GGCCTCTCTGGGCACCTGTGTGG + Intergenic
1122628808 14:103098088-103098110 GGGCCATCTGGGGACCTCACTGG + Intergenic
1202929008 14_KI270725v1_random:22853-22875 GGCCCCTCCCGGCACCTCCCTGG + Intergenic
1124234910 15:27981777-27981799 GGACCCTCTGAGGATCTCTGTGG + Intronic
1124405022 15:29384598-29384620 GGCCACTCTGGGCACCTCCAGGG + Intronic
1124920753 15:34023929-34023951 CCACTCTCTGGGCTCCTCTCTGG - Intronic
1128731370 15:70023739-70023761 GTTCCCACTGGGCTCCTCTCAGG - Intergenic
1128942831 15:71802439-71802461 GGGCCCTGTGGGCATCTCTCGGG - Intronic
1130167154 15:81473187-81473209 AGACAATCTGGGCCCCTCTCTGG - Intergenic
1130258086 15:82335047-82335069 GGCCCCCATGGGCACCTCCCTGG + Intergenic
1131144821 15:90003825-90003847 GCACCAGGTGGGCACCTCTCTGG - Intronic
1132239710 15:100248409-100248431 ATACCCTCTGGGCCTCTCTCTGG - Intronic
1132468658 16:89687-89709 GGACCCCCAGGGCACCGCTGTGG - Intronic
1133225312 16:4337945-4337967 GGTCCCTGGGGGCTCCTCTCAGG - Exonic
1135938084 16:26797990-26798012 GGACCCTCTGTGCAGCTGTGAGG - Intergenic
1136071610 16:27791011-27791033 TGCCCCTCTGGGCACCTGACTGG + Exonic
1138238587 16:55407350-55407372 GGAACCTCTGATCACATCTCAGG - Intronic
1140133267 16:72182998-72183020 AGACCCTCTGGGGACCTGGCAGG - Intergenic
1141138385 16:81481552-81481574 GCACCCTCTGGGAGCCGCTCTGG - Intronic
1141468985 16:84225781-84225803 TGGCCCTCTGGCCACCTCTCTGG + Intronic
1141982503 16:87559259-87559281 GGACCCTCTGAACTCCTCCCGGG + Intergenic
1141993660 16:87623758-87623780 GGACCCTCTGGGCAGATTTTGGG + Intronic
1142007330 16:87695694-87695716 GGCCCCTCTGGGAAGCTCCCAGG - Intronic
1142466389 17:139845-139867 GGACCCTGTGTGTACCTCTGTGG - Intergenic
1142743371 17:1942996-1943018 GGTCCCACTGGGGACATCTCTGG - Intronic
1143017657 17:3899524-3899546 GGACCCTCTGCTCCCCTCTGGGG + Intronic
1143135865 17:4711914-4711936 GCTCCCACTGGGCACCTCCCTGG + Intronic
1143801885 17:9390041-9390063 GGAGCCTCTGGGAACCACCCAGG + Intronic
1144834249 17:18148637-18148659 GGACCCTATGGGACCCTCTGGGG - Intronic
1145795704 17:27654234-27654256 GTCCCATCAGGGCACCTCTCGGG - Intergenic
1146002189 17:29138097-29138119 GCACTCTCTGGGCCCCTCACAGG + Intronic
1147155333 17:38541969-38541991 GGAGCCTCTGGGCTCCTTTCTGG - Intronic
1147384862 17:40075182-40075204 AGACCCTCTGGGCTCCTCAAGGG - Intronic
1148230100 17:45927448-45927470 GTCCACCCTGGGCACCTCTCTGG + Intronic
1148481118 17:47960103-47960125 GGAGGCTGTGGGCACCTTTCTGG - Intergenic
1149656227 17:58310866-58310888 GGACCCTTTTGCCATCTCTCTGG + Exonic
1150801299 17:68285231-68285253 AGACCTTCTGGGCACATTTCTGG - Intronic
1151674605 17:75591036-75591058 TGACCCTCTGCTCACCTCCCAGG + Intergenic
1152566491 17:81102751-81102773 GGCACCTCTGGGGGCCTCTCCGG - Intronic
1152865849 17:82722492-82722514 GCAGCCTGCGGGCACCTCTCAGG - Intronic
1152962215 18:86703-86725 TCACCCTCTTGACACCTCTCTGG - Intergenic
1157829022 18:50839764-50839786 AGACCCTCAGGGCACATCTTGGG - Intergenic
1160380409 18:78450457-78450479 CCTCCCCCTGGGCACCTCTCAGG - Intergenic
1161233599 19:3187434-3187456 GGTCCCTCTCGTCACATCTCAGG + Intronic
1162013314 19:7830672-7830694 TGACCCTCAGGACTCCTCTCCGG + Intronic
1164977090 19:32581407-32581429 GGAGGCTCTGGGCGCCTCCCCGG + Intronic
1165285532 19:34838798-34838820 GCAGGCTCTGGGCTCCTCTCTGG - Intergenic
1167585032 19:50369440-50369462 GGACCCTTTGGGTGACTCTCAGG + Intronic
1168104103 19:54156098-54156120 GGACGCCATGGGCACGTCTCTGG + Intronic
1168176007 19:54628484-54628506 GGACCCTATGACCACCTCTTTGG + Intronic
924965562 2:73413-73435 GGACCTCCGGGGCACTTCTCAGG - Intergenic
925890537 2:8430732-8430754 GGACCCTCTGGCTTCCCCTCTGG - Intergenic
926135592 2:10333428-10333450 GCAGCCTCTTGGCACCTCTCGGG + Intronic
929631014 2:43461959-43461981 GTTCCCTCTGGGCACCTTTTGGG - Intronic
930026332 2:47031381-47031403 GCTCCATCTGCGCACCTCTCTGG + Intronic
930177499 2:48315177-48315199 GGACCCTCAGGGCTCGGCTCGGG + Intronic
932593404 2:73080230-73080252 GGACCCTCAGGGCAGCTGGCGGG + Intronic
932760505 2:74436412-74436434 GGTCCCTCCGGGCACCTGGCTGG + Intronic
933851302 2:86368715-86368737 GGCTCCTGTGGGCACCTCTCTGG - Intergenic
934459848 2:94208086-94208108 GGCCCCTCCTGGCACCTCCCTGG + Intergenic
935340819 2:102058401-102058423 GGACCCTCAGTGCACCCCACTGG + Intergenic
935760586 2:106316942-106316964 GGACACACTGGTCACCTATCAGG + Intergenic
936153537 2:110034197-110034219 GAACCCTCTGGGAAACACTCAGG + Intergenic
936191144 2:110337218-110337240 GAACCCTCTGGGAAACACTCAGG - Intergenic
936737810 2:115467997-115468019 GTACCATCTGGGCCCTTCTCTGG - Intronic
937466331 2:122136180-122136202 GGACACTCTGGGTGCTTCTCTGG + Intergenic
945044066 2:205766429-205766451 AGTCCCTCCGGGCAACTCTCAGG + Intronic
947167876 2:227280934-227280956 GGACCCTCTATGCACCTTCCTGG - Exonic
947465717 2:230343245-230343267 ACACACTCTGGGCACCTGTCGGG - Intronic
948006897 2:234617131-234617153 GTACCCTCTGGGTGCCTCTCTGG - Intergenic
948592904 2:239062904-239062926 GTCCCCTCTCGGCACCCCTCTGG + Intronic
1169816473 20:9661950-9661972 AGCCCCTCTGGGCTCTTCTCTGG + Intronic
1170714262 20:18818264-18818286 GGCCACTCTGGGCTCTTCTCTGG + Intronic
1170795609 20:19544283-19544305 GTGCACACTGGGCACCTCTCAGG - Intronic
1172824371 20:37767982-37768004 GCACCCTCTGTACACATCTCAGG - Exonic
1173977154 20:47195677-47195699 GGACTCGCTGGTCACCTCTAAGG + Intergenic
1175251943 20:57615215-57615237 CCACCCTCAGGGCACCTCTGCGG - Intronic
1175287259 20:57845196-57845218 GGCCCCTCTGGTCATCTCGCTGG + Intergenic
1175526216 20:59635849-59635871 GGCCTCTCTGGGCAGGTCTCCGG + Intronic
1175781358 20:61684263-61684285 CCACCCTCTGAGCACCTCCCAGG - Intronic
1176092139 20:63322916-63322938 GGAGCCTCAGAGCACATCTCAGG + Intronic
1176591029 21:8651440-8651462 GGCCCCTCCCGGCACCTCCCTGG + Intergenic
1177824476 21:26066902-26066924 TCACCCTATGTGCACCTCTCTGG - Intronic
1179416237 21:41200734-41200756 GGTCCCTCTGCGCACATCCCTGG - Intronic
1179729151 21:43357915-43357937 GGACCCTCGGGGCAGCTCCCAGG + Intergenic
1180273857 22:10628473-10628495 GGCCCCTCCCGGCACCTCCCTGG + Intergenic
1180908243 22:19431084-19431106 GGACCGTCTGAGCACTTCTCGGG + Intronic
1181114126 22:20620697-20620719 AGACCCTCTGGGGACCTCCCAGG - Intergenic
1182361984 22:29752111-29752133 GGCCCCTCATGGCACCTGTCTGG - Intronic
1182416289 22:30223416-30223438 GGACACTGTGGGCCTCTCTCTGG - Intergenic
1184475851 22:44720875-44720897 CAACCCACTGGCCACCTCTCCGG - Intronic
1184522030 22:45000286-45000308 GGAGGCTCTGGTCACCTCTAGGG - Intronic
1184779170 22:46637750-46637772 GGGGCCCCTGGGCACCTCTGGGG + Intronic
1185097521 22:48819517-48819539 GGACCATGTGGGCACGCCTCGGG - Intronic
1185247580 22:49781308-49781330 AGACCCTTTGGGGACCTCCCGGG - Intronic
950583354 3:13877463-13877485 GGACCCTCTGAGCACCTAGCTGG + Intronic
952338828 3:32428215-32428237 GAGCCCTCTCAGCACCTCTCAGG - Intronic
953455311 3:43036089-43036111 AGCCCCTCTGTTCACCTCTCAGG + Intronic
954108884 3:48423421-48423443 GGACTCTCTGGGCAGCTCCTTGG + Intronic
954412697 3:50377941-50377963 TGACCCTGTGGGCACATCTCCGG + Intronic
956371711 3:68570654-68570676 AAACCCTCTGGGCTCCACTCTGG - Intergenic
961206717 3:125088239-125088261 GGACACCCTTGGCACCTCCCAGG + Intronic
962876928 3:139542253-139542275 GGACACTCTGACTACCTCTCAGG + Intergenic
964460434 3:156919181-156919203 GGAGCATCTGGGGACATCTCTGG - Intronic
967019640 3:185511509-185511531 GTACCCTCAGCTCACCTCTCCGG + Exonic
967266751 3:187698382-187698404 GGACAATCCGGTCACCTCTCTGG - Exonic
968531419 4:1093937-1093959 CGAGCCTCTGGGCACCTCCTTGG + Intronic
968663977 4:1810727-1810749 AGGCCCTGTGGGCACCTCACAGG - Intergenic
969253008 4:5982347-5982369 AGACTCTCTGGGCAGCTCACAGG - Intronic
969320472 4:6409507-6409529 GGCTGCTCTGGGCACATCTCAGG - Intronic
972751252 4:41990979-41991001 GGAACTTGTGGGCACCTCGCGGG + Intronic
974003056 4:56530371-56530393 GGACCTTCTGGGCGCATCTGGGG - Intergenic
984145201 4:176052065-176052087 GTCCCCTCTTGGAACCTCTCAGG - Intergenic
988460060 5:31427115-31427137 GTTGCCTCTGGGCACCTCACAGG - Intronic
993455080 5:88118463-88118485 TGACCCTGTGAGCCCCTCTCGGG - Intergenic
995531764 5:113098264-113098286 CGACTCTCTGGGGAGCTCTCAGG + Intronic
995599178 5:113777128-113777150 GGACCCTTGAGCCACCTCTCCGG - Intergenic
1000078328 5:157817455-157817477 GGACCTTCTGGGCAACTCATGGG - Exonic
1000869222 5:166554922-166554944 GGCCCCTTTGGGAACTTCTCAGG - Intergenic
1001237275 5:170040954-170040976 AGAACAACTGGGCACCTCTCTGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002945859 6:1760182-1760204 GGAGCCTCAGGGCACCTCGCAGG - Intronic
1003037993 6:2661804-2661826 CCACCCCCTGGGCACCTCCCTGG - Intergenic
1007170660 6:39861029-39861051 GACCCCTCTGGCCACATCTCAGG + Intronic
1016797204 6:148130923-148130945 GGGCCCTCTGGGCCCCTCTAGGG + Intergenic
1018995457 6:168706638-168706660 GGTTGCTCTGGGCACCTGTCGGG + Intergenic
1019137773 6:169922080-169922102 GCACGCTCTGAGCACCTCCCGGG + Intergenic
1021276976 7:18663607-18663629 GGATCCTTTGAACACCTCTCCGG + Intronic
1021826348 7:24556249-24556271 GGACCATCTGGGAAACTCTTGGG - Intergenic
1024554565 7:50592414-50592436 GGACCCTCTGGGAACATTTGGGG + Exonic
1027197396 7:76040081-76040103 GGACCACTAGGGCACCTCTCAGG - Intronic
1029420320 7:100468543-100468565 GGACCCTCTGGCCAGATCCCAGG - Intronic
1029530959 7:101125093-101125115 GGACCCCCTGGGCAGCACCCTGG + Intergenic
1032525643 7:132576940-132576962 GGCGCCTCTGCGCGCCTCTCTGG + Exonic
1036679339 8:10859467-10859489 GGACTCACTGGGCCCTTCTCAGG + Intergenic
1037754753 8:21703501-21703523 AGATTTTCTGGGCACCTCTCTGG - Intronic
1038859944 8:31375931-31375953 AAACCCTCTGGGCTCCTCACAGG + Intergenic
1040547087 8:48407177-48407199 GGACCCTGAGGGCTCCTCTCAGG + Intergenic
1041180508 8:55242798-55242820 GAACTCTCTGGACACATCTCTGG - Intronic
1044205370 8:89487109-89487131 GCTCCCTCTGTGCACCTTTCAGG - Intergenic
1047796625 8:128263490-128263512 TTACCCTCTTGGCTCCTCTCTGG + Intergenic
1048372242 8:133789278-133789300 GGACCTTCTTTGCACTTCTCAGG - Intergenic
1048508558 8:135042322-135042344 GGCCCCTCCTTGCACCTCTCAGG - Intergenic
1049161889 8:141103195-141103217 GGACCCTCTGAGGACCCCTTGGG + Intergenic
1049306927 8:141908878-141908900 GCACCCTATGGGCACCTTGCTGG - Intergenic
1049558512 8:143295911-143295933 GGAACCTCCGGGCCTCTCTCTGG - Exonic
1052258763 9:26490973-26490995 GGACACAGTGGGCACCCCTCTGG + Intergenic
1052660989 9:31431721-31431743 GGAACATCTGGGAACCACTCTGG + Intergenic
1052798507 9:32946253-32946275 CTACCTCCTGGGCACCTCTCTGG + Intergenic
1052836004 9:33250581-33250603 GGACTCTGTGGCCCCCTCTCTGG + Intronic
1053690349 9:40583894-40583916 GGACCCTCCCGGCACCTCCCTGG + Intergenic
1054301600 9:63384855-63384877 GGACCCTCCCGGCACCTCCCTGG + Intergenic
1057054318 9:91949503-91949525 GGACCCTCGGGGCACATCTGCGG + Intronic
1059319228 9:113454964-113454986 GGACTCTCTGGAGACCTCTGGGG + Intronic
1059325608 9:113502434-113502456 GACCCCTCTGGGCATCTCCCTGG - Intronic
1059340374 9:113594554-113594576 GGACCCTTTGGGGAACTCACTGG + Intronic
1059695629 9:116727671-116727693 AGACCCTCAGGGCATCTCTGTGG - Intronic
1060959327 9:127668249-127668271 GTTCACTCTGGGCACCTCGCGGG + Intronic
1061129986 9:128703226-128703248 GGACACTCTGGGGACCACCCTGG - Intronic
1061388890 9:130306318-130306340 GGACTCCCAGGGGACCTCTCTGG + Intronic
1062735925 9:138137414-138137436 TCACCCTCTTGACACCTCTCTGG + Intergenic
1203621044 Un_KI270749v1:130164-130186 GGCCCCTCCCGGCACCTCCCTGG + Intergenic
1185838470 X:3367406-3367428 CTACCTCCTGGGCACCTCTCTGG + Intergenic
1186190651 X:7064579-7064601 GGACCCTCTGGGCACCTCTCAGG - Intronic
1187644103 X:21328199-21328221 AAACCCTCTGGGCTCCACTCTGG - Intergenic
1196306159 X:114105583-114105605 GGCCTATCTGGGCACTTCTCTGG - Intergenic
1197790359 X:130248464-130248486 AAACCCTCTGGGCTCCACTCTGG - Intronic
1201237290 Y:11923490-11923512 CTACCTCCTGGGCACCTCTCTGG - Intergenic