ID: 1186190845

View in Genome Browser
Species Human (GRCh38)
Location X:7066291-7066313
Sequence ACGAGGCATGGATTTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186190845 Original CRISPR ACGAGGCATGGATTTTTTTG AGG Intronic
901008675 1:6184998-6185020 ACGAGGCTTTGTTTTTTTTAAGG - Exonic
901385533 1:8906235-8906257 ACTACTCATGGATTTTTTTTTGG + Intergenic
903586513 1:24419636-24419658 ACAAGGCAAGGGCTTTTTTGGGG + Exonic
903602135 1:24550244-24550266 ACCAGTCATGGGTTTTTATGAGG - Intergenic
909253642 1:73390436-73390458 TCTAGGCATGGTTTTTTTTTTGG + Intergenic
918321657 1:183370708-183370730 AAGAGGCATGCATATTTTTCTGG - Intronic
924189808 1:241538716-241538738 AGGTGGAATGGATTTCTTTGTGG + Intronic
1064770803 10:18720653-18720675 AAGAGGCATGGACTTTTTTCAGG - Intergenic
1065814440 10:29471295-29471317 AAGAGGCATGTATTGTTTTTAGG - Intronic
1069321384 10:67175779-67175801 ACCAAGCATGGATATTTTTCTGG - Intronic
1071837600 10:89434665-89434687 AGAAGGCAGGAATTTTTTTGAGG - Intronic
1073157467 10:101359031-101359053 AGGAGGCATCTCTTTTTTTGAGG + Intronic
1075499443 10:122959111-122959133 ACGAGACATGGGTTTTATTAGGG - Intronic
1077649296 11:3955379-3955401 ATGAGGCATGAATATTTTTAAGG - Intronic
1078451726 11:11445500-11445522 ACAAGGCAGGGATGTTTTTATGG + Intronic
1079195313 11:18321912-18321934 ACTAGGCAAGGAGCTTTTTGTGG - Intronic
1079942472 11:26698388-26698410 ACCAGGTATGGGTTTTCTTGAGG - Exonic
1084104765 11:66974236-66974258 AGGAGGCCTGGATTTTTTCCAGG - Intergenic
1084516840 11:69642106-69642128 ACGCGGCATGGGTAGTTTTGGGG + Intronic
1084559689 11:69896066-69896088 GGGAGGCATGGATTTTTTGTTGG + Intergenic
1087236249 11:95722050-95722072 AGGAGTCATGAATGTTTTTGTGG - Intergenic
1089409098 11:118223782-118223804 AAGGGGTATGGATTTTTTGGAGG - Intronic
1093522792 12:20069950-20069972 TGGATTCATGGATTTTTTTGAGG - Intergenic
1097309080 12:58099021-58099043 ATTAGGCATGGACATTTTTGGGG + Intergenic
1098033942 12:66283123-66283145 ATTAGGTATGGATTTTTCTGAGG - Intergenic
1104539912 12:129654608-129654630 ACAAAGCATGAATTTTGTTGGGG - Intronic
1106820385 13:33457726-33457748 AAGGGGCAGGGATCTTTTTGGGG + Intergenic
1107281542 13:38741767-38741789 TCTAGGCATGCATTTTTATGAGG + Intronic
1109101699 13:58192599-58192621 AAGAGGCATGCATTTTGTTCAGG - Intergenic
1112560174 13:100505869-100505891 AAGAGTGGTGGATTTTTTTGGGG - Intronic
1113138516 13:107120635-107120657 CCAAGGTATGGATTTTTTTAAGG - Intergenic
1113724719 13:112589643-112589665 ACAAGGCACCCATTTTTTTGTGG - Intergenic
1118193364 14:63601428-63601450 ACTAGGCATGCATGTTTTTCTGG - Intronic
1118565724 14:67138848-67138870 AAGAGGTATGGATTTGTCTGAGG - Intronic
1118950251 14:70429862-70429884 AGGTGGTATTGATTTTTTTGTGG + Intergenic
1121605984 14:95240423-95240445 ACGAGGCATGGAGGGTTGTGTGG - Intronic
1125446086 15:39758491-39758513 ACTGTCCATGGATTTTTTTGAGG + Intronic
1127281160 15:57494563-57494585 AGGAGGGATGGATTTTGTTTTGG + Intronic
1128199216 15:65791148-65791170 AACAGGCATGTATTTATTTGAGG - Intronic
1129998607 15:80027856-80027878 ACCATGCATGGCCTTTTTTGTGG - Intergenic
1130912482 15:88280660-88280682 AAGAGATATGGAGTTTTTTGGGG - Intergenic
1132800369 16:1749281-1749303 AACAGGCATGGATTTCTTTTAGG - Intronic
1133729729 16:8569166-8569188 AGGAGGGATGGATTTTTCTGGGG + Intergenic
1135049950 16:19184855-19184877 ATGATGCATGGATGTTTTTCAGG + Intronic
1135227015 16:20669770-20669792 AGGAAACATGGATTTTTTTCTGG + Intronic
1135338011 16:21620440-21620462 TCAAAGCATGGATTTTTTTAAGG - Intronic
1137743488 16:50803498-50803520 AGGAGGAATGGAGTTTTCTGAGG + Intergenic
1141839192 16:86563707-86563729 AAGAGGCATAGATTTTATTTGGG + Intergenic
1143326229 17:6100208-6100230 ATGAGGCATGGATGGGTTTGTGG + Intronic
1144236518 17:13266347-13266369 AGGAGGGATGGAATTTTTTAAGG - Intergenic
1151231682 17:72689653-72689675 ACTTAGCATGGATGTTTTTGAGG - Intronic
1153464765 18:5377058-5377080 AAGAGGCTTGAATTTTTCTGGGG - Intergenic
1156689922 18:39695403-39695425 AAGAGGCAGGCATTATTTTGTGG - Intergenic
1159261155 18:66015048-66015070 AAGAGGCATGAAGTTTTTTTTGG - Intergenic
1160024423 18:75206794-75206816 AAGAGGCATGGATTTTAAAGTGG + Intronic
1160128184 18:76198782-76198804 ACTGGGCATGGATTTATTTGGGG - Intergenic
1165352081 19:35281050-35281072 ACAAGCCAGGGATGTTTTTGGGG - Intronic
1167051316 19:47080456-47080478 ACGAGGCAAGGATTGTATTTTGG - Intronic
925902848 2:8520959-8520981 AAGAGGCAGGGATTTTCCTGAGG + Intergenic
926481512 2:13402499-13402521 AAGAAGTATGGATATTTTTGAGG - Intergenic
928013749 2:27635111-27635133 CCAAGGCTTTGATTTTTTTGTGG + Intronic
928551480 2:32375502-32375524 ACAAGGTCTGGAGTTTTTTGGGG - Intronic
930607294 2:53505777-53505799 ACAAGGCATGGGGTTTATTGAGG + Intergenic
933887470 2:86732471-86732493 ACGAGACGTGCTTTTTTTTGAGG + Intronic
933922706 2:87064240-87064262 ACGAGACGTGCTTTTTTTTGAGG - Intergenic
937851444 2:126639638-126639660 ACGAGGCACAGAGTATTTTGAGG - Intergenic
938652603 2:133399266-133399288 AAGAGGGGTGGAATTTTTTGTGG + Intronic
939461716 2:142504703-142504725 TCTTAGCATGGATTTTTTTGGGG - Intergenic
940668097 2:156633520-156633542 AAGAGGCATGATTTTTTTGGTGG - Intergenic
941618341 2:167749045-167749067 AAGATGCATGTATTTTTGTGAGG + Intergenic
944901421 2:204220435-204220457 CTGAGGCATGAATATTTTTGTGG - Intergenic
945254367 2:207791528-207791550 ACGATCCATGGATGTTTTTGGGG - Intergenic
945881839 2:215332706-215332728 ATGAGGCAGGAATTTGTTTGTGG + Intronic
946889692 2:224262302-224262324 ACAAATTATGGATTTTTTTGAGG - Intergenic
947194050 2:227543112-227543134 TGGATTCATGGATTTTTTTGAGG + Intronic
1171148521 20:22806467-22806489 AGGAGAACTGGATTTTTTTGAGG + Intergenic
1171197330 20:23210296-23210318 ACAAGGTATGGTTTATTTTGAGG - Intergenic
1172290359 20:33771579-33771601 ATCAGGTATGGATTTTATTGGGG + Intronic
1174691246 20:52508404-52508426 AAGACGCATGGATTTATTTCTGG - Intergenic
1178243808 21:30933119-30933141 TCTAGGCAAAGATTTTTTTGGGG + Intergenic
1178997129 21:37413037-37413059 AAGAGACATGGATTATTTGGAGG + Intronic
1179337639 21:40473023-40473045 ACGGGGCACGGATTTATTTGAGG + Intronic
1182219632 22:28747880-28747902 AAGAGGAACAGATTTTTTTGGGG - Intronic
1182708363 22:32304279-32304301 ACCATGCATGGCTATTTTTGTGG + Intergenic
1183139141 22:35919563-35919585 ACGGGGAATGGAGTTTCTTGTGG + Intronic
1184568219 22:45306215-45306237 ATGAGACATGGAGTTTATTGAGG - Intergenic
949973443 3:9431835-9431857 ATTAGGAATGGATTTTTTTTTGG - Intronic
951486741 3:23221409-23221431 AAAAGGCATGGATTATTTTTTGG - Intronic
953373192 3:42407131-42407153 TGGAGGCCTGGATTATTTTGAGG - Exonic
956531701 3:70227005-70227027 AAGATGCATGTATTTTTTCGAGG - Intergenic
958564599 3:95793316-95793338 AAGGGGCCTGGATTTGTTTGGGG + Intergenic
962114570 3:132489609-132489631 ATGGAGCATGGATTTTTTTTTGG + Intronic
963053744 3:141165536-141165558 ACAAGAAATGGATTTTTTTTTGG - Intergenic
964497085 3:157302748-157302770 AAGAAGCTTAGATTTTTTTGTGG - Intronic
968838011 4:2979722-2979744 ACCACACATGGATTTTTTTTGGG - Intronic
972901709 4:43693016-43693038 TAGATGCATGGATTTTTTTCTGG + Intergenic
972918547 4:43908191-43908213 ATAAGGCATTGATTTTTTTCTGG - Intergenic
977129837 4:93222194-93222216 AGGAGGAATTTATTTTTTTGTGG + Intronic
978386172 4:108177494-108177516 ATGAGGCATGGACTATTGTGGGG - Intergenic
978746610 4:112201944-112201966 ACGAGACATACATTTTATTGGGG + Intergenic
979203549 4:118007939-118007961 ACAAGGCAAGGAGTTTTTTTAGG - Intergenic
979853097 4:125597870-125597892 ACGAGGCATAGATTTTTAGCAGG + Intergenic
986900513 5:12425713-12425735 ACTAGGGTTGGATTATTTTGGGG - Intergenic
988811303 5:34787615-34787637 TCGATACAGGGATTTTTTTGAGG + Intronic
988978244 5:36537132-36537154 AAGAGGAATGGCTTTCTTTGAGG + Intergenic
989627244 5:43441800-43441822 TGGAGTCATGGATTTTTTGGAGG + Intergenic
992245947 5:74822691-74822713 AAGAGGTATGGATATTTATGTGG - Intronic
998820047 5:146049890-146049912 AGGAGTCATGGATAGTTTTGGGG - Intronic
999919175 5:156299249-156299271 TAGATGCATGGATTTATTTGGGG + Intronic
1000280729 5:159779738-159779760 AAGAGGAAAGGATTTCTTTGGGG + Intergenic
1000305304 5:159989024-159989046 CCTAGAAATGGATTTTTTTGAGG + Intergenic
1004029251 6:11849997-11850019 AGGAGGAATGGATTTGTATGAGG + Intergenic
1008292984 6:49740702-49740724 AAGAGGAATCGATTGTTTTGAGG - Intronic
1012660179 6:101879313-101879335 AAGAAGCATGTATTTTTTTCTGG - Intronic
1015553869 6:134440843-134440865 ATGAGGCATTGATTCTTGTGAGG - Intergenic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1017372168 6:153724461-153724483 ACTAGGCCTGGAGTTCTTTGTGG - Intergenic
1018079682 6:160248017-160248039 ACTTGGAATGGATGTTTTTGTGG + Intronic
1021632290 7:22659228-22659250 ACGAATCCTTGATTTTTTTGGGG - Intergenic
1021880957 7:25094891-25094913 ACAATGCATGGATTTTATTTGGG - Intergenic
1022610277 7:31864829-31864851 ACGAGTCATGCATTGTTTTATGG - Intronic
1022658849 7:32347298-32347320 ACATGGTATTGATTTTTTTGAGG + Intergenic
1027146547 7:75699594-75699616 TCGAGGGCTGGATTCTTTTGCGG - Intronic
1028817582 7:95164987-95165009 ATGTGACATGGAGTTTTTTGGGG - Intronic
1036986359 8:13535882-13535904 ACCAGCCATGCATTTATTTGTGG + Intergenic
1037472700 8:19225914-19225936 ATGAGGATAGGATTTTTTTGGGG - Intergenic
1039550528 8:38439967-38439989 AGGATGCCTGGATTTTGTTGGGG - Intronic
1041159464 8:55024439-55024461 ATCAGGCATGGGTTTTTGTGTGG - Intergenic
1041608613 8:59816702-59816724 TGGATTCATGGATTTTTTTGAGG - Intergenic
1046242745 8:111518472-111518494 AAGAAGAATTGATTTTTTTGAGG + Intergenic
1046339805 8:112838607-112838629 CCAAGGCATAGATTTTTGTGTGG - Intronic
1047087328 8:121532582-121532604 ACGTGGAATAGATTTTGTTGTGG + Intergenic
1050201831 9:3153190-3153212 AAGAGTCATAGATTTTTTTGAGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057158062 9:92861861-92861883 TCTAGACATGGATTTATTTGAGG - Intronic
1058138896 9:101337922-101337944 AGGAGTCATTGATTTGTTTGGGG - Intergenic
1059865900 9:118513686-118513708 AAGAGGAATGGATTTTTGTCTGG + Intergenic
1060416963 9:123437534-123437556 CCAAGGCGAGGATTTTTTTGAGG + Intronic
1186190845 X:7066291-7066313 ACGAGGCATGGATTTTTTTGAGG + Intronic
1186933096 X:14416317-14416339 ACGGGTCATGGATTTTCTTTGGG - Intergenic
1190367687 X:49712268-49712290 AAGAGGCAGGCATTATTTTGTGG - Intergenic
1193259091 X:79384052-79384074 ATGAGGCTTGTATTATTTTGAGG - Intergenic
1196657179 X:118230573-118230595 AAGAGCTATGGATTTTTTAGGGG - Intergenic