ID: 1186193595

View in Genome Browser
Species Human (GRCh38)
Location X:7089772-7089794
Sequence AAGGCTTCACACATATACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186193593_1186193595 26 Left 1186193593 X:7089723-7089745 CCACTCACGCACTGTTTACAGCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1186193595 X:7089772-7089794 AAGGCTTCACACATATACCATGG 0: 1
1: 1
2: 0
3: 16
4: 193
1186193592_1186193595 27 Left 1186193592 X:7089722-7089744 CCCACTCACGCACTGTTTACAGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1186193595 X:7089772-7089794 AAGGCTTCACACATATACCATGG 0: 1
1: 1
2: 0
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186193595 Original CRISPR AAGGCTTCACACATATACCA TGG Intronic
902725078 1:18330103-18330125 AAGGCTTTCCACAGATAGCAGGG - Intronic
907926183 1:58957062-58957084 AAGGCTTCACACTTATAAGAAGG - Intergenic
908292493 1:62682429-62682451 AGTGCTTCACACAGATCCCATGG - Intronic
909145037 1:71919285-71919307 AAGGGATCACCAATATACCAAGG + Intronic
909231159 1:73092686-73092708 AAGGCTTTCCACATATTCAAAGG + Intergenic
910722434 1:90301552-90301574 GAGGCTTCACACTTAAGCCAAGG + Intergenic
911554029 1:99320843-99320865 AAGGTGTCACAAATATACAATGG + Intergenic
911624142 1:100102161-100102183 AAGCCTTAACAAATATATCAAGG + Intronic
917234006 1:172871141-172871163 AAGGCTTCTCAAAGAGACCAAGG + Intergenic
918361439 1:183763023-183763045 AATGTGTCACACATATACCATGG + Intronic
919391089 1:196986726-196986748 AATGCGGCACACATACACCATGG - Intronic
920722562 1:208401249-208401271 AAGGCCTCACATATATTTCAGGG + Intergenic
920982992 1:210855749-210855771 ATGGCTTCACACATAGTCAAGGG + Intronic
924721515 1:246627372-246627394 ACAGCTTCTCAGATATACCAAGG + Intronic
1066038545 10:31520668-31520690 AATGCTTCACCCATACAACAAGG + Exonic
1066060898 10:31722784-31722806 AAGCCTTCCCACAGATATCAGGG + Intergenic
1069074810 10:64027811-64027833 AAGGTGACACATATATACCATGG + Intergenic
1069851450 10:71407800-71407822 AAGTCTTCACACACTTGCCAGGG - Intronic
1070600868 10:77865417-77865439 AGGGCTTCTCTCATATCCCAGGG - Intronic
1072346404 10:94511901-94511923 AAGGCATCACACTGATATCAGGG - Intronic
1072507147 10:96079616-96079638 TAGGGTTCTCACATCTACCAGGG - Intergenic
1073163776 10:101425158-101425180 AATGCAGTACACATATACCATGG - Intronic
1073689615 10:105793311-105793333 AAGGCCTCACACATCTGACAAGG + Intergenic
1073890229 10:108092057-108092079 AAGGCTTTCCACATATTCAAAGG - Intergenic
1074709563 10:116166156-116166178 AATGTTGTACACATATACCATGG - Intronic
1078310685 11:10238102-10238124 AAGGATTCAAAAATATAACATGG + Intronic
1078742897 11:14084506-14084528 AATGCATCACATATACACCATGG - Intronic
1080148273 11:29016828-29016850 AATGCACCACATATATACCATGG + Intergenic
1082750641 11:57011657-57011679 AATGTGGCACACATATACCATGG - Intergenic
1086730127 11:90238500-90238522 AAGACTTCCCACCTATAACATGG + Intergenic
1088725276 11:112629095-112629117 AATGCCTCAAACATAGACCATGG + Intergenic
1091417659 12:303295-303317 AATGCAGCACATATATACCATGG + Intronic
1095140940 12:38661241-38661263 AATGTGGCACACATATACCATGG + Intronic
1095952588 12:47789954-47789976 AAGGCTTCACACAGGAGCCAGGG + Intronic
1096232333 12:49903505-49903527 AAGGCTCCTCACAGATACCCAGG - Intronic
1097371617 12:58788578-58788600 ATGTATGCACACATATACCATGG - Intronic
1098637573 12:72803031-72803053 AAGTTTTGACACATATACTAAGG - Intergenic
1099251043 12:80254649-80254671 AAGACATCTCATATATACCAAGG + Intronic
1099327740 12:81241193-81241215 AATGTGGCACACATATACCATGG - Intronic
1099498565 12:83382485-83382507 AAGGTGGCACATATATACCATGG + Intergenic
1100575639 12:95889570-95889592 AAGGCTTCAGGCTTATACCAGGG + Intronic
1102523577 12:113494696-113494718 AAGGCCTCACACAGTTACCTTGG + Intergenic
1103166997 12:118778759-118778781 AAGGCTTCATGCAGACACCAGGG + Intergenic
1104499549 12:129271768-129271790 AATGTGGCACACATATACCATGG - Intronic
1104539036 12:129645230-129645252 GAGGCTTCACCTACATACCAAGG + Intronic
1104603741 12:130172038-130172060 AAAGCTTCACGCATGTCCCAGGG + Intergenic
1105341047 13:19526317-19526339 AATGTGGCACACATATACCATGG + Intronic
1105878086 13:24577613-24577635 AATGTGGCACACATATACCATGG - Intergenic
1108563388 13:51669775-51669797 AAGACTTCTCACATATATCATGG - Intronic
1108941067 13:55953399-55953421 AATGTGGCACACATATACCATGG + Intergenic
1108961457 13:56237180-56237202 AGGGCATCCCACAAATACCATGG - Intergenic
1112161783 13:96875826-96875848 AGGGCTTCAAACATCTACCTGGG - Intergenic
1114482742 14:23045652-23045674 AAGGCTTGATACAGATATCACGG + Intergenic
1115860520 14:37681152-37681174 AAGGCTTACCACATATGCTATGG + Intronic
1116692756 14:48131401-48131423 AATGTGGCACACATATACCATGG - Intergenic
1119574881 14:75711212-75711234 AAAGCTGCACCCAAATACCAGGG - Intronic
1120171360 14:81249589-81249611 AAGGCATCAAACATAGAACATGG + Intergenic
1122829648 14:104389556-104389578 AAGCCTTCAGACACACACCAGGG - Intergenic
1125357883 15:38835298-38835320 AATGTGTCACATATATACCATGG - Intergenic
1126228755 15:46300744-46300766 GAGGCCTCACACATCTTCCAGGG + Intergenic
1134899626 16:17925481-17925503 AATGCGGCACATATATACCATGG - Intergenic
1136038924 16:27562609-27562631 AAGTCTTCACTCATACACTATGG + Intronic
1138545755 16:57718499-57718521 AAGCCTTCACACACATTCCCTGG - Intronic
1138941297 16:61793611-61793633 AATGTGGCACACATATACCATGG - Intronic
1140228117 16:73095019-73095041 AAGTCTTCATAGATAAACCATGG + Intergenic
1141419938 16:83907777-83907799 ACGGCTTCACAGAGATCCCAAGG + Intronic
1144256343 17:13472123-13472145 AAGAAATCACACATCTACCAGGG + Intergenic
1144688557 17:17243411-17243433 AGGGCATTACACAAATACCAAGG - Intergenic
1145104150 17:20101023-20101045 AATGCGTCACATATACACCATGG - Intronic
1145410168 17:22653357-22653379 AAAACTTGGCACATATACCATGG + Intergenic
1146600432 17:34210104-34210126 AATGTGGCACACATATACCATGG - Intergenic
1148436108 17:47686882-47686904 AAGGCTTTACACATTTGCCCTGG + Intergenic
1150117471 17:62566413-62566435 AATGTTTCACACATAAAACAAGG - Intronic
1150946387 17:69750931-69750953 AATGTGGCACACATATACCATGG + Intergenic
1151821165 17:76497655-76497677 CAGGCTGCACACCTTTACCACGG + Intronic
1152330808 17:79671510-79671532 AAGGCTCCACACATCTCCCCTGG + Intergenic
1153224473 18:2888285-2888307 AATGCTTTGCTCATATACCACGG - Intronic
1155856801 18:30844647-30844669 AAAGGGTCACACATACACCATGG - Intergenic
1156925482 18:42572953-42572975 AATGCTGCACATATATACCATGG + Intergenic
1158015593 18:52779511-52779533 AATGCAACACATATATACCATGG - Intronic
1158113960 18:53974121-53974143 AATGTGTCACATATATACCATGG - Intergenic
1158145163 18:54304118-54304140 AATGTGTCACATATATACCATGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
925491130 2:4394916-4394938 AAGGCTTTCTACATATTCCAAGG + Intergenic
925770854 2:7281968-7281990 AAGGGGTCACACAGACACCAGGG - Intergenic
925877541 2:8325952-8325974 ATGGCTGCTCACATTTACCAGGG + Intergenic
927921049 2:26971833-26971855 CAGGCCTCACACCTACACCATGG - Intronic
928626769 2:33147866-33147888 AGGGCTTGACACATATCCCTTGG - Intronic
930177948 2:48319222-48319244 ATGGCTTCTCACAGAGACCAGGG - Intronic
930855011 2:56005973-56005995 AGGACATCATACATATACCACGG - Intergenic
932031598 2:68192204-68192226 AATTTTTTACACATATACCAAGG + Intronic
932874426 2:75435593-75435615 AAGGTGTCACATATACACCATGG + Intergenic
933338295 2:80987726-80987748 AAGGCTTTCCACATATTCAAAGG - Intergenic
935808229 2:106770078-106770100 ACGGATTCACACACATACCTTGG - Intergenic
939651434 2:144767317-144767339 AAGGGTTAACACATTTTCCAGGG + Intergenic
939707764 2:145477121-145477143 AAGGTTTTCCACATATTCCAAGG + Intergenic
942000485 2:171641640-171641662 AAGGTAGCACATATATACCATGG - Intergenic
943012941 2:182473847-182473869 AAGGTGGCACATATATACCATGG - Intronic
943106537 2:183550764-183550786 AATGCGGCACATATATACCATGG + Intergenic
943441612 2:187933498-187933520 AAGGCTCCACCCATATAGCAGGG + Intergenic
945210458 2:207376830-207376852 AATGCAGCACATATATACCATGG - Intergenic
946530150 2:220562000-220562022 AATGTTTTACATATATACCATGG + Intergenic
947897112 2:233685628-233685650 AAGTTTTCGAACATATACCAAGG + Intronic
1169814255 20:9640419-9640441 AATGTTGCACATATATACCATGG - Intronic
1172394264 20:34588524-34588546 TAGGCTTCCCACATACATCATGG + Exonic
1177275846 21:18912520-18912542 AAGGCTTTCCACATATTCGAAGG + Intergenic
1182973215 22:34597063-34597085 AATGTGTCACATATATACCATGG - Intergenic
1183316487 22:37139825-37139847 CAGGCTTCCCACCCATACCATGG - Intronic
1184711884 22:46255353-46255375 AAGGCTGCACACAGTTAGCAAGG - Intergenic
949370483 3:3329232-3329254 ATGGCTTCACCCAGATACCAAGG - Intergenic
950561453 3:13730754-13730776 AATGTATCACATATATACCATGG - Intergenic
951982858 3:28584714-28584736 AATGTTGCACATATATACCATGG + Intergenic
952008748 3:28875096-28875118 AAGGCTTTCCAGATATTCCAAGG + Intergenic
955243775 3:57204771-57204793 AAGGTTTCACTCATATATCCAGG - Intronic
956330482 3:68101466-68101488 AATGTGGCACACATATACCATGG + Intronic
956386965 3:68729695-68729717 AATGTGTCACATATATACCATGG - Intergenic
958725823 3:97905101-97905123 AATGTGTCACATATATACCACGG - Intronic
963691124 3:148504224-148504246 AAGGTGGCACACATATACCATGG - Intergenic
964168386 3:153736774-153736796 AAGGATTCACACACTTACTACGG - Intergenic
965194805 3:165580171-165580193 AATGTGGCACACATATACCATGG + Intergenic
966216222 3:177505779-177505801 AAGGCTTCACCTCAATACCATGG + Intergenic
968374662 4:29017-29039 CATGTGTCACACATATACCAGGG - Intergenic
970295337 4:14623807-14623829 AATGTGTCACATATATACCATGG + Intergenic
970691305 4:18624123-18624145 AAGGCTTCTCGCATAAACTATGG + Intergenic
971674802 4:29612430-29612452 AATGCTGCACATATACACCATGG - Intergenic
971895408 4:32586738-32586760 AAGGCTCCAAGAATATACCAGGG - Intergenic
972061396 4:34878055-34878077 AACGTGTCACATATATACCATGG + Intergenic
973290856 4:48468883-48468905 AATGTGGCACACATATACCATGG - Intergenic
974054669 4:56973603-56973625 AAGGCTGAAAAGATATACCAAGG + Intronic
974085946 4:57261628-57261650 AATGTTGCACATATATACCATGG + Intergenic
975330876 4:73111110-73111132 AAGGTTTCAGGCATCTACCAGGG - Intronic
976588715 4:86827578-86827600 AAAGCTTCAAAAATATACCAAGG + Intronic
980281957 4:130734499-130734521 AATGTGGCACACATATACCATGG + Intergenic
980633420 4:135468339-135468361 AATGTGTCACATATATACCATGG - Intergenic
981855787 4:149290433-149290455 AAGGTGGCACATATATACCATGG + Intergenic
982875524 4:160643912-160643934 AAGAATTGACACATATATCAAGG - Intergenic
982915639 4:161204967-161204989 AATGCCTCACATATACACCATGG + Intergenic
983454684 4:167948267-167948289 AAAGCATCTCACAAATACCAGGG + Intergenic
984152961 4:176157388-176157410 AAGGATTAACACATTTGCCATGG + Intronic
986591152 5:9372414-9372436 ATGGTTCCACACATATCCCATGG - Intronic
987969556 5:24924869-24924891 AATGTGTCACACATACACCATGG - Intergenic
988009434 5:25463607-25463629 AAGGCATCACAGATTTACCAAGG - Intergenic
988422382 5:31022284-31022306 AATGTGTCACATATATACCATGG - Intergenic
993291494 5:86077880-86077902 AATGTGTCACATATATACCATGG - Intergenic
993542125 5:89164840-89164862 AATGTGTCACATATATACCATGG + Intergenic
995814270 5:116149213-116149235 AATGTGTCACATATATACCATGG - Intronic
998219213 5:140262472-140262494 ATGGCTTCACACAGAATCCATGG + Intronic
1000809320 5:165841102-165841124 AAGTCTTCACACATATACACAGG + Intergenic
1001650828 5:173314908-173314930 AAGGCTTCACGGAAATAGCATGG - Exonic
1006805297 6:36784491-36784513 TTGGGTTCACACATATATCAAGG - Intronic
1009377189 6:62987488-62987510 AATGTTTCACATATATACCATGG + Intergenic
1009457422 6:63873360-63873382 AATGTGTCACATATATACCATGG - Intronic
1009734461 6:67659043-67659065 AATGTGTCACATATATACCATGG - Intergenic
1010361293 6:74997518-74997540 GAGGCATCACAGAGATACCAAGG + Intergenic
1013025559 6:106268659-106268681 AATGTGTCACATATATACCATGG + Intronic
1014426380 6:121311987-121312009 AATGCGGCACACATACACCATGG + Intronic
1021556319 7:21922376-21922398 TAGGCTGAACACATATATCAGGG + Intronic
1023034084 7:36115750-36115772 AAGTGTTCACAGCTATACCAAGG - Intergenic
1024450874 7:49541380-49541402 AATGTGTTACACATATACCATGG - Intergenic
1027827767 7:83137801-83137823 AATGCTTCAAACATATAGAAAGG - Intronic
1027947346 7:84765634-84765656 AACGTGTTACACATATACCATGG - Intergenic
1028708211 7:93875187-93875209 AAGGCTTAACAAATAAAACATGG + Intronic
1035545600 8:479954-479976 AAGGCTTCACTCATATAGGCAGG + Intergenic
1036835233 8:12058652-12058674 AAGGTGGCACACATATACCACGG + Intergenic
1036857074 8:12305216-12305238 AAGGTGGCACACATATACCACGG + Intergenic
1037360898 8:18072441-18072463 AAAACCTCATACATATACCAGGG - Intronic
1038877823 8:31571122-31571144 AATGTGGCACACATATACCATGG + Intergenic
1039155098 8:34546013-34546035 AATGTGGCACACATATACCATGG + Intergenic
1040136625 8:43861903-43861925 AAGGGCTCACAAATATTCCATGG - Intergenic
1040730094 8:50434247-50434269 AATGTGGCACACATATACCATGG - Intronic
1041389663 8:57337515-57337537 AAAACTTCACCTATATACCAGGG - Intergenic
1041478062 8:58287318-58287340 AATGCGGCACATATATACCATGG - Intergenic
1042782998 8:72512314-72512336 ATGACTTCACACATACACCATGG + Intergenic
1043726453 8:83617653-83617675 AATGTTTCACATATACACCATGG - Intergenic
1044962162 8:97542206-97542228 CAGACTTCACACATACTCCAAGG - Intergenic
1044970075 8:97610841-97610863 AATGTGGCACACATATACCATGG - Intergenic
1046027644 8:108744835-108744857 AAGGCCTCAGACATCTACAAAGG - Intronic
1046572284 8:115981413-115981435 AAGGTGGCACATATATACCACGG + Intergenic
1048908713 8:139113650-139113672 AAGGCTTCATAGATATAGAAAGG + Intergenic
1050340615 9:4634288-4634310 CAAGCTTCTCACATGTACCATGG + Intronic
1050684581 9:8153442-8153464 AAGGTGGCACATATATACCATGG + Intergenic
1051614135 9:18991349-18991371 AATGCATCACATATACACCATGG + Intronic
1051652914 9:19347776-19347798 AATGCTACACAAATATAACATGG - Intronic
1055869246 9:80854701-80854723 AATGCAGCACACATACACCATGG - Intergenic
1056656970 9:88517395-88517417 AAGGTGGCACATATATACCATGG - Intergenic
1057941553 9:99289519-99289541 AAGGCTTCTCAGAGATACCGTGG + Intergenic
1058121471 9:101144049-101144071 AATGTGGCACACATATACCATGG + Intronic
1058503040 9:105641246-105641268 TAGTCTGCACACATATACCTGGG + Intergenic
1061554023 9:131355338-131355360 AAGGCTAGACACATAGACAATGG - Intergenic
1203574558 Un_KI270744v1:165134-165156 CATGTGTCACACATATACCAGGG + Intergenic
1186193595 X:7089772-7089794 AAGGCTTCACACATATACCATGG + Intronic
1186520199 X:10199540-10199562 ACCGGTTCACACATATGCCAGGG - Intronic
1188737330 X:33734328-33734350 ACGGCTTCACATATAAACCATGG - Intergenic
1188905492 X:35786530-35786552 AAGGCTTCATCTATATAACAAGG - Intergenic
1189840694 X:45073230-45073252 AATGCAGCACACATACACCATGG - Intronic
1189993615 X:46618017-46618039 AAGGCTTCAGAAAGCTACCAAGG + Intronic
1190819914 X:53964018-53964040 AATGTGGCACACATATACCATGG + Intronic
1191062759 X:56317335-56317357 CTTGCTTCACTCATATACCATGG + Intergenic
1194133444 X:90110142-90110164 AATGCACCACATATATACCATGG + Intergenic
1194575829 X:95613307-95613329 AATGTGACACACATATACCATGG - Intergenic
1196553811 X:117062816-117062838 AATGTTTCACATATACACCATGG + Intergenic
1197977042 X:132176800-132176822 AAGGCTTTACACATTTATGAAGG + Intergenic
1198605307 X:138331059-138331081 AAGGCAGCACACTTTTACCAGGG - Intergenic
1198715392 X:139552992-139553014 AAGGTATTACACATATACCTGGG + Intronic
1198989636 X:142496918-142496940 AATGTTTCACATATACACCATGG - Intergenic
1199467692 X:148157753-148157775 AAATGTACACACATATACCAAGG - Intergenic
1199740296 X:150729320-150729342 ATGGCTACACACATACACCTTGG - Intronic
1199823579 X:151475382-151475404 AATGTGGCACACATATACCATGG - Intergenic
1200479224 Y:3680245-3680267 AATGCAGCACATATATACCATGG + Intergenic
1200900967 Y:8431466-8431488 AAGGTTTTTCACATATCCCATGG - Intergenic
1201565504 Y:15361303-15361325 AAGGCTTCACACATACACCATGG + Intergenic