ID: 1186194727

View in Genome Browser
Species Human (GRCh38)
Location X:7099001-7099023
Sequence TGGCCCAGATACCATGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186194720_1186194727 24 Left 1186194720 X:7098954-7098976 CCGGCCAGGCTGAGGAGCACATC 0: 1
1: 0
2: 0
3: 22
4: 293
Right 1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 150
1186194721_1186194727 20 Left 1186194721 X:7098958-7098980 CCAGGCTGAGGAGCACATCTGCA 0: 1
1: 0
2: 0
3: 22
4: 213
Right 1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186194727 Original CRISPR TGGCCCAGATACCATGCCCT GGG Intronic
900425858 1:2578290-2578312 TGGCCCAGACCCCATGAGCTGGG + Intergenic
900718541 1:4160410-4160432 TGGCACAGGGACCATGGCCTTGG + Intergenic
901639803 1:10687477-10687499 TGGCCCACATACCACGCCCGGGG + Intronic
903953433 1:27009740-27009762 TAGGCCAGATGCCAAGCCCTGGG - Intronic
907587563 1:55634730-55634752 TGGCTCTGATCCCAGGCCCTTGG + Intergenic
911532681 1:99064174-99064196 TGGCCTAGATACCATGATCTAGG + Intergenic
914346767 1:146806656-146806678 TGGCCCAGATTCCCCTCCCTGGG - Intergenic
915572002 1:156749889-156749911 TGGCCCAGATGCCAAGGCCCTGG - Intronic
917166121 1:172115200-172115222 AGGACTAGATGCCATGCCCTTGG - Intronic
919848861 1:201658975-201658997 TGTTCCAGTTGCCATGCCCTGGG + Intronic
919848998 1:201659890-201659912 TGTTCCAGTTGCCATGCCCTGGG + Intronic
923156573 1:231284597-231284619 TGTCCCAGCCACCATGCCCTGGG - Intergenic
924722665 1:246637946-246637968 TTGCCCAGGTACCTGGCCCTGGG + Intronic
924767226 1:247045343-247045365 TGACCCAGATGCCTTCCCCTAGG - Intronic
1063784708 10:9367522-9367544 AGGCCCAGAGACCATGCTTTGGG + Intergenic
1067693792 10:48521041-48521063 TGCCCCAGAAACAATACCCTCGG + Intronic
1067838184 10:49654481-49654503 TGGCCCAGTTACCATGCATAAGG + Intronic
1070664918 10:78336175-78336197 TGCCCAAGTTTCCATGCCCTGGG + Intergenic
1070721423 10:78759912-78759934 AGGCCCAGATGCCAAGCTCTGGG - Intergenic
1074359050 10:112810639-112810661 TGGTCCAGTTACCATGGCCAGGG + Intronic
1075850420 10:125581840-125581862 AGGCCCAGATGCCATGAACTGGG + Intronic
1076407443 10:130222034-130222056 TGGGCCAGGCACCATGACCTTGG - Intergenic
1076791550 10:132779382-132779404 GGGCACAGATGCCATCCCCTGGG + Intronic
1077305954 11:1868763-1868785 TGGCCCTGACACCCTGCCCAGGG - Intronic
1078527979 11:12114979-12115001 TGACCCAGAAACCTGGCCCTGGG + Intronic
1083170243 11:60919900-60919922 TGGGCCAGAGACCATGCACCTGG + Exonic
1084690111 11:70720162-70720184 TCTCCCAGGTACCAGGCCCTGGG - Intronic
1092695584 12:11167661-11167683 TGGCCCAGATCTCCTGACCTCGG + Intronic
1094007651 12:25772476-25772498 TGTCCCAGATCCTCTGCCCTTGG + Intergenic
1100575450 12:95887947-95887969 TGGCCCAGATCCCTTCCTCTGGG + Intronic
1101067665 12:101039557-101039579 TGGCCCAGGGGCCATGCCCAAGG - Intronic
1103445443 12:120991975-120991997 TGGCCCAAATAGCTTTCCCTGGG + Intronic
1103829476 12:123767499-123767521 TGGGCCACATACCAACCCCTTGG + Intronic
1104548721 12:129735992-129736014 TGGCCCAGGTTCCGTGGCCTAGG - Intronic
1105787394 13:23762863-23762885 TGCAACAGATGCCATGCCCTTGG + Intronic
1108848191 13:54699954-54699976 CGGGCCAGATCCCATGCCCAAGG + Intergenic
1111132224 13:83992111-83992133 TGGCCATGATACCAGACCCTTGG - Intergenic
1114398140 14:22385241-22385263 TGGCAAAGAAACCAAGCCCTGGG + Intergenic
1117787188 14:59298466-59298488 TGGCCCTGATGAGATGCCCTCGG + Intronic
1117828297 14:59726407-59726429 AGGCCCAAATCCCTTGCCCTTGG + Intronic
1118919052 14:70133328-70133350 TGGTCCTGACACCAGGCCCTGGG + Intronic
1202904550 14_GL000194v1_random:60651-60673 TGGCCCAGAGGCCTTCCCCTTGG - Intergenic
1129147272 15:73659986-73660008 TGGCCCTGATTTCCTGCCCTGGG + Intergenic
1131304721 15:91231867-91231889 TGGCACAGACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132852603 16:2031504-2031526 TGGCCCAGGCACCTTGCCTTGGG + Intronic
1133056680 16:3148914-3148936 TGGCCCTGATCCCCTGACCTAGG + Exonic
1135206155 16:20485843-20485865 TGGCTCAGTTGCCATGCCATTGG - Intronic
1137020512 16:35421168-35421190 TGACCCAGGGACCATGCCTTAGG + Intergenic
1139450772 16:67026902-67026924 TGGCCCAGACACCATGCTATGGG - Intergenic
1139987214 16:70908614-70908636 TGGCCCAGATTCCCCTCCCTGGG + Intronic
1141432783 16:83979477-83979499 TGGAGCAGATACCATCCTCTGGG + Intronic
1142376493 16:89709463-89709485 TGCCCCAGGGACCTTGCCCTGGG + Intronic
1143191913 17:5046121-5046143 TGTCTCAGATTCCATGCCTTTGG - Intronic
1143737484 17:8923090-8923112 TGGGCCAGATACCATGCTTAGGG + Intronic
1143888307 17:10083489-10083511 TGCGGCAGATAGCATGCCCTGGG - Intronic
1144014134 17:11177835-11177857 TGGCCCAGAAAATATCCCCTTGG + Intergenic
1144793432 17:17874856-17874878 AGGCCCAGAGACTATGACCTGGG + Intronic
1151630793 17:75309477-75309499 TGGCCCTGAAACCATGGCCACGG - Intergenic
1153750700 18:8227242-8227264 GGGCCCAGATCCCATTCACTGGG - Intronic
1154384290 18:13879626-13879648 TGGCCCAGAGCTCATGCCCTGGG - Intergenic
1157990661 18:52491977-52491999 TGTCCCTAATACCATGTCCTGGG + Intronic
1159806251 18:72961762-72961784 TGGCCCAGTTACCCTTCACTGGG + Intergenic
1162000961 19:7744890-7744912 TTGGCCAGAAGCCATGCCCTAGG + Intronic
1162052680 19:8044219-8044241 TGCCCCAGATACTCTGCACTTGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162969857 19:14174118-14174140 TGGCCCAGTTCCCATGTCCGTGG - Intronic
1163177676 19:15575847-15575869 TGGCCAAGATCCCAGGTCCTGGG - Intergenic
1163228297 19:15980215-15980237 TGATCCAGATCCCATGCCTTTGG + Intergenic
1164574519 19:29397923-29397945 TGGGCCACATGCCGTGCCCTGGG - Intergenic
1168059784 19:53884377-53884399 TGGCCCAGATTCCTTGCCCTTGG + Intronic
925048820 2:795664-795686 TGGCCCACAGAGCCTGCCCTGGG + Intergenic
926322166 2:11756226-11756248 TGTCCCAGATAACGTGCCTTAGG + Intronic
927204770 2:20600228-20600250 TGGCCCAGTGACCCTGCCCCTGG + Intronic
927894475 2:26772588-26772610 TGGGCCAGATCACATGCTCTTGG + Intronic
927894970 2:26775763-26775785 TGTGCCATATACCAAGCCCTGGG + Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
932183141 2:69667755-69667777 TGGCTCAGCTGCCATGGCCTTGG - Intronic
932508165 2:72256962-72256984 AGGCCCAAATTCCATGCCCCTGG - Intronic
933567759 2:83971747-83971769 TGGCCCAGATAAAATTGCCTTGG - Intergenic
937241505 2:120465268-120465290 TGGCCCAGCCACCATCCTCTAGG - Intergenic
937548943 2:123062319-123062341 TGGCCCAGAAACCGTCGCCTTGG + Intergenic
938133509 2:128736207-128736229 TGGGCCAGAAACCCAGCCCTAGG + Intergenic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
944526748 2:200627300-200627322 TGGGCAAGAGACCCTGCCCTAGG - Intronic
945092628 2:206189817-206189839 TGTCCCAAATACCACCCCCTGGG - Intronic
946070968 2:217033994-217034016 TGGCCAAGATAGCATGAGCTAGG - Intergenic
946158875 2:217823933-217823955 TGGCACAGAATCCATGCCTTTGG - Intronic
947500808 2:230669434-230669456 TGGCCCAGCTCCCCAGCCCTTGG + Intergenic
948177407 2:235954921-235954943 TGGCCCATCTACCATGTGCTTGG - Intronic
1169780331 20:9302450-9302472 TGCCCCTGATGCCAGGCCCTAGG + Intronic
1171186210 20:23126070-23126092 TGGCACAGATACAGTGGCCTGGG + Intergenic
1172640124 20:36435854-36435876 TGCCCCAGAAGCAATGCCCTAGG - Intronic
1172883466 20:38216504-38216526 TGGCCCAGACCCAGTGCCCTTGG - Intronic
1172897512 20:38310771-38310793 TGGCCCCCATACCATGCCTGAGG - Intronic
1173073863 20:39797349-39797371 TGGCCCAGGTACCATCACCTTGG + Intergenic
1173775441 20:45702381-45702403 AGGCCCAGATACTATGCCCAAGG - Intronic
1174292216 20:49517281-49517303 TGGGCCAGATAAAATGGCCTTGG - Intronic
1175075684 20:56370760-56370782 TGGGCCAGATCCTGTGCCCTAGG + Intronic
1175408449 20:58750649-58750671 TGCCCCAGGTACTGTGCCCTGGG - Intergenic
1175786560 20:61715813-61715835 CGGCCCAGGTCCCATGCACTGGG + Intronic
1176101670 20:63367310-63367332 TGGCCCAGAGACCGTGCAGTGGG + Intronic
1176232618 20:64039887-64039909 TGTGGCAGATCCCATGCCCTGGG - Intronic
1177088813 21:16740584-16740606 TGGCCCAGGTTACATGCCCATGG + Intergenic
1178362727 21:31962974-31962996 TGAACCAGATAAGATGCCCTGGG - Intronic
1178468456 21:32870573-32870595 TGGCTCTGAGACCAGGCCCTGGG - Intergenic
1179408489 21:41144142-41144164 TGGCCCAAGTGCCAAGCCCTGGG + Intergenic
1180238423 21:46480572-46480594 TGGCACAGAGACCTTGCCTTGGG + Intronic
1183493417 22:38128523-38128545 TGTCCCAGCTCCCAGGCCCTGGG + Intronic
950899804 3:16487229-16487251 TGGGCCAGATGCCATGTCTTGGG - Intronic
955974553 3:64467713-64467735 TGGCCCAGATGCCTACCCCTGGG - Intergenic
956398251 3:68848571-68848593 TGGCAATGATACCATGCACTTGG + Intronic
961007685 3:123415735-123415757 TAACCCAAACACCATGCCCTTGG + Intronic
965491077 3:169337520-169337542 TGGCCCTGATACAAACCCCTAGG + Intronic
969329169 4:6463266-6463288 TGGCACAGCTGCCGTGCCCTTGG - Intronic
969721582 4:8895308-8895330 TGGCCCTGAGACCAGGCCCTTGG - Intergenic
969838738 4:9864899-9864921 TGGCCAAGGCACCATGCCCAAGG - Intronic
974546953 4:63323613-63323635 TGGCCCAGATACAAAGACCTGGG + Intergenic
975034999 4:69669071-69669093 AGGCCCAGAGACCATGGACTGGG + Intergenic
976299659 4:83506101-83506123 TTGCCCAGGTACCTGGCCCTGGG + Intronic
980960647 4:139471077-139471099 TGGCCCAGAGACAGTGCGCTGGG - Intronic
985931761 5:3063921-3063943 TGGCCCAGGAAGCATGACCTGGG - Intergenic
988299327 5:29403097-29403119 TGGCCCAGATACAATAGACTTGG + Intergenic
988865553 5:35330797-35330819 GGGCCCAGATACCTTCCACTGGG - Intergenic
989632247 5:43497313-43497335 TGGAGCAGATACTATGCGCTAGG + Intronic
991344686 5:65651220-65651242 TAGCCCAGACAACATGACCTAGG + Intronic
992471710 5:77063210-77063232 TGACCCAGGGACCATGCCTTGGG + Exonic
994523468 5:100872922-100872944 TGGCCTAGACAATATGCCCTAGG - Intronic
995033345 5:107505421-107505443 TTTCCCATATAGCATGCCCTAGG - Intronic
998419502 5:141970549-141970571 TGGCTCAGTTAGCCTGCCCTAGG + Intronic
1001780473 5:174364612-174364634 TGGCCCAGGGACCATGCTTTGGG - Intergenic
1003242807 6:4359179-4359201 TGGCCCAGCCATCATGTCCTGGG + Intergenic
1007693211 6:43716148-43716170 TGGCCCAGCTCCCAGGGCCTGGG + Intergenic
1014790918 6:125670891-125670913 TGTCCCAGATACTATGCCTCTGG + Intergenic
1016866513 6:148772753-148772775 TGGCCCAGATCTCATGTCTTAGG - Intronic
1017096014 6:150805924-150805946 TGGGCCAGTGATCATGCCCTGGG + Intronic
1018669925 6:166169203-166169225 GGGCGCAGATACCATGTCCGCGG - Intergenic
1019255164 7:45024-45046 TAGCACATACACCATGCCCTGGG - Intergenic
1023516733 7:41008870-41008892 GGGACCAGATACCATCCCTTCGG - Intergenic
1029275796 7:99403658-99403680 TGGCCCAGGTCCCATTCCCTGGG - Intronic
1032723600 7:134570906-134570928 TTGTCTAGATTCCATGCCCTGGG + Intronic
1033529361 7:142247137-142247159 TGGGCCAGGCACCATGCCATGGG + Intergenic
1036459408 8:8938654-8938676 TGGCCCAGATTCCTGGCCCGTGG + Intergenic
1042158472 8:65868457-65868479 TTGCCCAGGTACCTGGCCCTGGG - Intergenic
1046727228 8:117689201-117689223 TGGCCATGTTACCATGCTCTGGG - Intergenic
1047337563 8:123951245-123951267 TTGACCAGATCCCATCCCCTAGG - Intronic
1050125400 9:2352289-2352311 TGTTCCAGATACCTTGCCCTGGG - Intergenic
1050616910 9:7410791-7410813 TGTCCCTTATACCCTGCCCTTGG + Intergenic
1050870523 9:10563078-10563100 TTACACAGATATCATGCCCTAGG - Intronic
1052483128 9:29057724-29057746 CGGGCCAGATACCATGGCTTCGG + Intergenic
1055272950 9:74582399-74582421 TGGCTCAGAGCCCATGCCCTAGG + Intronic
1057225281 9:93289635-93289657 TGTCCCAGAGACACTGCCCTGGG + Intronic
1058210638 9:102164375-102164397 AGACACAGATACCATGCTCTTGG + Intergenic
1060141288 9:121212556-121212578 TGTCGCAGATACCATGCTCTGGG - Intronic
1061090568 9:128423677-128423699 TGGCCCAGATAGCCTGCCGAAGG - Intronic
1061789926 9:133053820-133053842 TGTCCCAGATAACAGGCCCCTGG + Exonic
1061932973 9:133842810-133842832 GGGCCCGGCTCCCATGCCCTGGG - Intronic
1185446353 X:259875-259897 TGGACCATAAACCCTGCCCTGGG + Intergenic
1185604335 X:1359217-1359239 TGCCCCAGATTCCTTACCCTGGG + Intronic
1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG + Intronic
1186201270 X:7157639-7157661 TTGGCCAGGCACCATGCCCTGGG + Intergenic
1197772470 X:130098037-130098059 TGGCCCAGACAGCCTGCCCAGGG + Intronic
1200153005 X:153960400-153960422 TCCCCCAGATACCATGGCCTGGG - Exonic
1202275887 Y:23119127-23119149 TGGCCCAGAGACCATTTTCTGGG - Intergenic
1202290141 Y:23301564-23301586 TGGCCCAGAGACCATTTTCTGGG + Intergenic
1202428881 Y:24752846-24752868 TGGCCCAGAGACCATTTTCTGGG - Intergenic
1202441910 Y:24917243-24917265 TGGCCCAGAGACCATTTTCTGGG + Intergenic