ID: 1186196846

View in Genome Browser
Species Human (GRCh38)
Location X:7117465-7117487
Sequence TGTTCTGCTAGATAACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186196846_1186196847 14 Left 1186196846 X:7117465-7117487 CCTTTAGGTTATCTAGCAGAACA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1186196847 X:7117502-7117524 AAAGCATGCTATGTGTAACCTGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186196846 Original CRISPR TGTTCTGCTAGATAACCTAA AGG (reversed) Intronic
900753792 1:4418941-4418963 TGTCCTGGTAGAGAACCCAAGGG - Intergenic
901896260 1:12315385-12315407 TACTCTGCTAGATTTCCTAAAGG - Intronic
908958721 1:69669234-69669256 TGTTCTGCCAGAAATGCTAAAGG - Intronic
909505580 1:76385951-76385973 TGTTCTGATAGGAAACCAAATGG + Intronic
911852892 1:102840957-102840979 TGTTCCAGTAGATAACCTCAAGG - Intergenic
912261727 1:108117459-108117481 TCTTCAGGTAGATAACATAAGGG + Intergenic
914220085 1:145673477-145673499 TGTACTGGTAGCTAACCTAAAGG + Intronic
914472666 1:147996343-147996365 TGTACTGGTAGCTAACCTAAAGG + Intergenic
915072363 1:153280964-153280986 TTCTCTGCCTGATAACCTAATGG - Intergenic
916274828 1:162982405-162982427 TGCTCTGCAAGATGACCTTAAGG + Intergenic
916432746 1:164747491-164747513 TGTTCTGCTAGATAGACTTTAGG + Intronic
916517671 1:165534890-165534912 CTTTCTGCTAGTTAACCAAAGGG + Intergenic
916770008 1:167898818-167898840 TGTGCTGCTAGATGAGCCAAAGG - Intronic
919248426 1:195019636-195019658 AGGTCTGCTAGATGTCCTAATGG - Intergenic
920588325 1:207191144-207191166 TGTTCTGATAGATGGCATAAGGG - Intergenic
1063585530 10:7349217-7349239 TGTTCTGCTCGATCTCCAAATGG + Intronic
1066451638 10:35535305-35535327 TGTTCCAGTAGATAACCTCAAGG + Intronic
1070015770 10:72529148-72529170 TATTCTTGTAGATAACATAAAGG + Intronic
1070570360 10:77636554-77636576 TGTTCCACTAGAGCACCTAAGGG + Intronic
1071229633 10:83570620-83570642 TGTTCTGGAAGATAAACAAAAGG + Intergenic
1073310661 10:102538377-102538399 AGTTCTGCTAATTTACCTAAGGG - Intronic
1073595575 10:104796363-104796385 TTTTCTCCTTGATATCCTAAAGG - Intronic
1074429789 10:113384678-113384700 TCTTCTGCTTAAGAACCTAAAGG - Intergenic
1076129276 10:128001725-128001747 TGTTCTGGGAGATAACGTATGGG + Intronic
1080035818 11:27709697-27709719 TGTTCAGATAGATATCGTAAGGG + Intronic
1081199544 11:40199825-40199847 TATTCTGCTAGATAACTCCAGGG + Intronic
1083043079 11:59707071-59707093 TGTTCCAGTAGATAACCTCAAGG - Intergenic
1083825987 11:65204446-65204468 TGCTCTGCTCGCTAACCTAACGG + Intronic
1094165667 12:27440333-27440355 TGTTGTGCAAGAAAAGCTAACGG + Intergenic
1094618077 12:32054351-32054373 TGTTCCAGTAGATAACCTCAAGG - Intergenic
1095545833 12:43368444-43368466 TTTTCTGTTAGAGAACTTAAAGG - Intronic
1098142674 12:67467218-67467240 TGTTCTGCAAGAAATGCTAAAGG - Intergenic
1102094123 12:110221686-110221708 TGATCTGCTAGTTGATCTAAAGG - Intergenic
1106511170 13:30413881-30413903 TGTTCTTCTTGATTAGCTAATGG - Intergenic
1110298945 13:73902972-73902994 TGTCCTATTAGATAAACTAATGG - Intronic
1114600265 14:23950615-23950637 TGTTCCTGTAGATAACCTCAAGG + Intergenic
1115438127 14:33400544-33400566 TGTTCTGCCAGATAAATTAATGG + Intronic
1115646937 14:35375039-35375061 TGTTTTGCCAAATTACCTAAGGG + Intergenic
1116012405 14:39366710-39366732 TGCTCTGCCAGGAAACCTAAGGG - Intronic
1118629583 14:67690380-67690402 TCTGCTGCTAGAGAAACTAAAGG - Exonic
1122427044 14:101616572-101616594 TGTACTGCAAGAAATCCTAAAGG + Intergenic
1125319775 15:38473048-38473070 TGTTCAGCAAGACAACATAAGGG - Intronic
1126184216 15:45815143-45815165 TGTTCCAGTAGATAACCTCAAGG - Intergenic
1128914268 15:71545656-71545678 TGTTCTGCTACCTAACTAAAGGG - Intronic
1129497850 15:76003913-76003935 TGTTCTGCAAGAAAAACTCAGGG + Intronic
1130395475 15:83497296-83497318 TGTCCCGGTAGATAACCTCAAGG - Intronic
1131013401 15:89038201-89038223 TGGTCTGCTACGTAACCTCAGGG + Intergenic
1131040732 15:89264097-89264119 TGCTCTGCTATATAAACCAAGGG - Intronic
1133122183 16:3616194-3616216 TGTTCTGCTAGACAAATTTAAGG + Intronic
1134377682 16:13693150-13693172 TGTTCCAGTAGATAACCTCAAGG + Intergenic
1141387028 16:83631186-83631208 AATTCTGCCAGATAACCTGAGGG - Intronic
1142919794 17:3174418-3174440 TGTTCTACAAGAAATCCTAAAGG + Intergenic
1144152853 17:12467217-12467239 TGTTCACTTAGATAACCTACTGG - Intergenic
1146414893 17:32622616-32622638 TGTTCTCCCAGATAACTGAATGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148529267 17:48373552-48373574 TGTTTTGTTAGATAGCCTATGGG + Intronic
1148689726 17:49520276-49520298 TGTTGTGCTGGAGACCCTAAGGG - Intergenic
1150057814 17:62035209-62035231 TGTTCTTTTAGATAGCATAATGG - Intronic
1154124416 18:11677083-11677105 TGGGCTGCTGGATAACCTATGGG - Intergenic
1159216480 18:65397969-65397991 TCTTCTGATAAAGAACCTAAAGG + Intergenic
1164278666 19:23748408-23748430 TGTTCCAGTAGATAACCTCAAGG - Intronic
1166594606 19:44034454-44034476 TATTCTAGTAGATAACCTCAAGG + Intergenic
1168679742 19:58305837-58305859 TGTTCCTGTAGATAACCTCAAGG - Intronic
925242414 2:2343446-2343468 AGATATGCCAGATAACCTAAAGG - Intergenic
926420886 2:12697420-12697442 TTTTTTGCTAGTTAATCTAAAGG - Intergenic
928956900 2:36878602-36878624 TGTTCTACTTGTTGACCTAAGGG + Intronic
936470869 2:112797694-112797716 TGGTGTGTTAGAGAACCTAAAGG + Intergenic
937705475 2:124915569-124915591 TGGTATGCTACAGAACCTAAGGG - Intergenic
942302518 2:174575371-174575393 TCTTCTTCTACAGAACCTAAAGG - Exonic
944655436 2:201872592-201872614 TGGTCTGCAAGAAAACCTAGTGG + Intronic
946006428 2:216529143-216529165 TGTTGTGTTAGATAAGCCAAGGG + Intronic
1169360968 20:4948522-4948544 TGCTCTAATAGATTACCTAAGGG + Intronic
1173426329 20:42946607-42946629 TTTTTTGCCAGATAATCTAATGG - Intronic
1174490221 20:50887737-50887759 TTTTCTTCTAGATTACCTCATGG + Intergenic
1176345781 21:5745621-5745643 TATTCTGCTTGATGACCTTAAGG + Intergenic
1176352595 21:5866205-5866227 TATTCTGCTTGATGACCTTAAGG + Intergenic
1176499046 21:7578834-7578856 TATTCTGCTTGATGACCTTAAGG - Intergenic
1176540102 21:8143691-8143713 TATTCTGCTTGATGACCTTAAGG + Intergenic
1176559053 21:8326736-8326758 TATTCTGCTTGATGACCTTAAGG + Intergenic
1184309050 22:43629367-43629389 TGTTATGCTGGATACCCTGAGGG - Intronic
1203245047 22_KI270733v1_random:60050-60072 TATTCTGCTTGATGACCTTAAGG + Intergenic
951826177 3:26871574-26871596 TGTTCTGTAAGAGAACCTAGAGG - Intergenic
952450602 3:33428908-33428930 TCTTCTACTGGATATCCTAATGG + Intronic
958841219 3:99208287-99208309 TGTTCTGTTACAAAACTTAATGG + Intergenic
960315607 3:116172801-116172823 AGTTTTGCTTGATAACCTAAAGG + Intronic
965013718 3:163129455-163129477 TGTTCCAGTAGATAACCTGAAGG + Intergenic
970255137 4:14160247-14160269 TGTTCTGCATGATACCATAATGG - Intergenic
975737169 4:77392511-77392533 TGTTCCAGTAGATAACCTCAAGG + Intronic
975737950 4:77400018-77400040 TGTTCCAGTAGATAACCTCAAGG + Intronic
977380572 4:96268140-96268162 TGTTCAGCTAGATATCCCAATGG - Intergenic
980347369 4:131637872-131637894 TGTTCTGCAAGAAATACTAAAGG + Intergenic
981221586 4:142243229-142243251 TTTTCTCCTAGTTTACCTAAAGG + Intronic
986525037 5:8664590-8664612 TCTTCGCCTACATAACCTAAGGG - Intergenic
986580273 5:9258547-9258569 TGTTCCCCTGGATAACCTAAGGG - Intronic
987610290 5:20194358-20194380 GGTTATGCTAGACAACCTCATGG + Intronic
989975654 5:50583645-50583667 TGTTGTGGTAGATAAAATAATGG + Intergenic
991699687 5:69305652-69305674 TGTTCCAGTAGATAACCTCAAGG - Intronic
994446678 5:99883539-99883561 AGTTCTGCTAGAAAACTTTATGG + Intergenic
999889860 5:155965649-155965671 TGTTCCAGTAGATAACCTCAAGG - Intronic
1005167191 6:22938237-22938259 ATTCCTGCTAGAGAACCTAAGGG - Intergenic
1005485581 6:26296079-26296101 TGTTCCTATAGATAACCTTAAGG + Intergenic
1006176705 6:32126901-32126923 TTCACTGCTAGATAACCAAAGGG + Intronic
1011231050 6:85162420-85162442 TGTTCTGCTTAAATACCTAATGG - Intergenic
1011447157 6:87453313-87453335 TGTTCTGCAAGAAAAGTTAAAGG + Intronic
1012174686 6:96065833-96065855 TGATCTGCAAGATAACAGAAAGG + Intronic
1012532095 6:100250477-100250499 TGTTCTGATAGAAAACATTAGGG + Intergenic
1013209985 6:107978090-107978112 GTTTCCGCTAGATTACCTAAAGG - Intergenic
1013896230 6:115091748-115091770 TGCTCTTCTAGATAACCACATGG + Intergenic
1014098040 6:117481804-117481826 CGTGCAGCTAAATAACCTAAAGG - Intronic
1018959011 6:168433145-168433167 TGTACTGCTAGATAAAATAATGG + Intergenic
1024438295 7:49385014-49385036 TGTTCTGCAAGATATCATAATGG - Intergenic
1027642687 7:80756738-80756760 TATTCTGCTAGATAACGTCTTGG + Intronic
1031762456 7:125730981-125731003 TGTTGTGGTTGATATCCTAAAGG + Intergenic
1038940395 8:32297995-32298017 TGTTCTCACAGATAAACTAAGGG - Intronic
1042048693 8:64683888-64683910 TGTTCTTCTAGATACCCTCGTGG + Intronic
1042789942 8:72594021-72594043 TATTATGCTAGATACCGTAAGGG + Intronic
1045588772 8:103568698-103568720 TGTTCTTCTAGCTTACATAAGGG + Intronic
1046027290 8:108740071-108740093 TGTTCTGCTACTTGACATAATGG + Intronic
1047621591 8:126613208-126613230 TGGTCTCCTAGATAGCCTCAGGG - Intergenic
1048695276 8:137021043-137021065 TGTCCTGCTAGATAAATGAATGG - Intergenic
1051488840 9:17638204-17638226 TGTTTTGCAAGATATCCTAGAGG + Intronic
1051820829 9:21165507-21165529 TGTTCACCTGGATATCCTAAGGG + Intergenic
1055466067 9:76567915-76567937 ATTTCTATTAGATAACCTAATGG + Intergenic
1056709544 9:88979573-88979595 TGTTCTACTAGGCAACTTAAAGG - Intergenic
1058779399 9:108318132-108318154 TGTTATGATAGATAAGCCAATGG + Intergenic
1059019387 9:110557567-110557589 TTTTCTGCTAAATAAAATAAAGG - Intronic
1203461382 Un_GL000220v1:43129-43151 TATTCTGCTTGATGACCTTAAGG + Intergenic
1186196846 X:7117465-7117487 TGTTCTGCTAGATAACCTAAAGG - Intronic
1186359415 X:8824172-8824194 TTTTCTCCAAGATAACCTGATGG - Intergenic
1187788792 X:22924533-22924555 GGTTCTACTAGATAACCTATAGG + Intergenic
1188091049 X:25966212-25966234 TGTACTGCTTGATATCCTAGAGG + Intergenic
1188335947 X:28933322-28933344 TGTTCTGGTAGATATCATGATGG - Intronic
1189023326 X:37365316-37365338 TGTTCCAGTAGATAACCTCAAGG + Intronic
1189488737 X:41453156-41453178 TGTTCTCCTAGCAAACCTCAAGG + Intronic
1197783186 X:130176634-130176656 TCTTCTGCCAGTTAACTTAATGG + Intronic
1198765689 X:140077306-140077328 TGTTCCCCCAGGTAACCTAATGG - Intergenic
1198977991 X:142358825-142358847 TGCTCTGTTAGGTAAACTAAAGG - Intergenic