ID: 1186200014

View in Genome Browser
Species Human (GRCh38)
Location X:7147783-7147805
Sequence CCCACGCGCGGGCCGCCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 60}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186200005_1186200014 4 Left 1186200005 X:7147756-7147778 CCAGGGACTGCTCCCACGTGCTC 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200003_1186200014 6 Left 1186200003 X:7147754-7147776 CCCCAGGGACTGCTCCCACGTGC 0: 1
1: 0
2: 1
3: 22
4: 145
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200002_1186200014 14 Left 1186200002 X:7147746-7147768 CCGGTGGACCCCAGGGACTGCTC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200001_1186200014 15 Left 1186200001 X:7147745-7147767 CCCGGTGGACCCCAGGGACTGCT 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200004_1186200014 5 Left 1186200004 X:7147755-7147777 CCCAGGGACTGCTCCCACGTGCT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200008_1186200014 -9 Left 1186200008 X:7147769-7147791 CCACGTGCTCCGGCCCCACGCGC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200000_1186200014 18 Left 1186200000 X:7147742-7147764 CCGCCCGGTGGACCCCAGGGACT 0: 1
1: 0
2: 1
3: 17
4: 159
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186199999_1186200014 19 Left 1186199999 X:7147741-7147763 CCCGCCCGGTGGACCCCAGGGAC 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186200007_1186200014 -8 Left 1186200007 X:7147768-7147790 CCCACGTGCTCCGGCCCCACGCG 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60
1186199996_1186200014 26 Left 1186199996 X:7147734-7147756 CCGCGCGCCCGCCCGGTGGACCC 0: 1
1: 0
2: 1
3: 19
4: 191
Right 1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186200014 Original CRISPR CCCACGCGCGGGCCGCCGAC CGG Intronic
900159135 1:1215298-1215320 CCCACGGGTGGGCCGAGGACAGG - Intergenic
900283867 1:1890365-1890387 CCCCCGCGCGGGCCGCCTATCGG - Intronic
902478410 1:16699815-16699837 CCGAGGCGCGGGCAGCCGGCGGG + Intergenic
903233934 1:21937494-21937516 CCTCCGCGCGGGCCGCGGCCCGG + Intergenic
910773383 1:90851574-90851596 ACCACGCGCGGGCTCCCGCCGGG + Intergenic
914753139 1:150549294-150549316 CCCACCCCGGGGCCGCCGAGGGG + Intergenic
923141220 1:231162675-231162697 CCACCGCGAGGGCAGCCGACCGG + Intronic
923744399 1:236686811-236686833 ACCACGCGCGGGCGGCCCGCGGG - Intronic
924623964 1:245685267-245685289 CCCACGTGCGGGAGGCCAACGGG + Intronic
1065188927 10:23193236-23193258 CCCAGGCGCCCGCCGCCGCCCGG - Exonic
1066464668 10:35641495-35641517 CCCACGAGAGAGCCGCAGACGGG + Exonic
1070326856 10:75395421-75395443 CCAGCGCGCGGGCAGCCGGCTGG - Intergenic
1074503343 10:114044973-114044995 CCCGCGCCCGCGCCGCCGCCCGG + Exonic
1082835591 11:57648364-57648386 CCCACGCGCCAGCCTCCGAGTGG + Exonic
1083572588 11:63768440-63768462 CCCACGCCGGGGCCCCCGCCCGG + Intronic
1085011252 11:73142727-73142749 CCCACGTGCGCGCCCCCGAGCGG - Intergenic
1092654643 12:10672236-10672258 CCAACACCCGGGGCGCCGACAGG + Intronic
1102056517 12:109900474-109900496 CGCCCGCGCGGGCCGCCTGCGGG - Intronic
1108676027 13:52738948-52738970 CCCGAGCGCGGGCCGGCGAGGGG - Intronic
1122208471 14:100159943-100159965 CCCACCCGCGGGCAGCCGTCGGG + Exonic
1124006460 15:25798887-25798909 CCCACTCGGAGGCCCCCGACTGG + Intronic
1128067657 15:64774975-64774997 CGCGCGCGCCGGCCGCCGTCCGG - Intronic
1133038398 16:3046889-3046911 CCCCAGCCCGGGCCGCCGGCGGG - Exonic
1139387030 16:66579358-66579380 TCCACGCGCCGGCCCCCGACGGG - Intergenic
1142509727 17:385983-386005 CCCAGGCTCCGGCCGCCGGCGGG + Intronic
1142619137 17:1154019-1154041 CCCACGCGCCCGCCCCCGAGTGG - Intronic
1149994611 17:61400086-61400108 CCACCGCGCGCGCCGCCGCCCGG + Exonic
1150624334 17:66832045-66832067 CCCACGGTTGGGCCGCGGACTGG - Intergenic
1153238878 18:3013187-3013209 ACCCCGCGCGCGCCCCCGACCGG - Intronic
1157464205 18:47930536-47930558 CGCGCGCCCGGGCCGCCGGCCGG - Exonic
1158976757 18:62716596-62716618 CACCCGCCCGGGCCGCCGACGGG - Exonic
1160745376 19:708930-708952 CCCCCGCGCCCGCCGCCGCCCGG + Intergenic
1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG + Intronic
1161400825 19:4065746-4065768 CCCACGGGCGGGGGGCCGAGGGG + Intronic
1161707234 19:5827845-5827867 CGCACGCGCGCGCCGCCGCCGGG - Exonic
1163666957 19:18607701-18607723 CCCACCCGCGGGCCGCTGAGTGG - Intronic
1165349389 19:35268097-35268119 CCCGCGCCCGCGCCGCCGGCCGG + Intergenic
1168339435 19:55614901-55614923 CCCACGCGGGGGCGGGCGCCGGG + Exonic
1202712429 1_KI270714v1_random:25646-25668 CCGAGGCGCGGGCAGCCGGCGGG + Intergenic
925424739 2:3739540-3739562 CACACCGGCAGGCCGCCGACCGG + Intronic
927844413 2:26464023-26464045 CCCCCGCGCAGGCTGCCGCCTGG - Exonic
931649455 2:64454680-64454702 CCCACGCGCCGGGCGCCGGCCGG - Intronic
942450949 2:176107745-176107767 CCCGCCCGCGGGCCGCCGGCCGG + Exonic
945272052 2:207950592-207950614 CCCACACGCGGGACGTTGACGGG + Intronic
1168753094 20:297645-297667 CCCCCGCGCGGCCCGCGGCCCGG + Exonic
1171173553 20:23035290-23035312 CCACCGCGCGGGCGCCCGACTGG - Intergenic
1178931171 21:36820364-36820386 GCCACGGCCGGGCCGCCGACTGG + Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
954624791 3:52016539-52016561 CCCACGTGCGGGGCACCTACTGG - Intergenic
960942303 3:122943037-122943059 CCCAGGTGCAGGCCGCCGGCTGG + Intronic
962129866 3:132660712-132660734 CCCCCGCGCCTGCCTCCGACCGG - Exonic
966878363 3:184336171-184336193 CCCACCCGCGGCCCGCGCACCGG - Intronic
968659521 4:1793360-1793382 CGCACCGGCGGGCCGCCGGCCGG + Exonic
970456229 4:16226572-16226594 GCCATCCGCGGCCCGCCGACCGG + Intronic
979547128 4:121951431-121951453 CCGAGGCGCGGGCCGCGGCCGGG + Intronic
981573201 4:146175822-146175844 CCGCTGCGCGGGCCGACGACGGG + Exonic
1020201219 7:6081538-6081560 CCCACGCGCGCGCCGCAGTTTGG + Intergenic
1027361761 7:77416496-77416518 CTCAGGTGCGGGCCGCCGGCCGG - Intergenic
1032298768 7:130668323-130668345 CCTGCGCGCGGGCCTCCGGCGGG - Intronic
1033660678 7:143399766-143399788 CCCACGCGCGGGCCAGCCCCAGG - Exonic
1035171227 7:157018380-157018402 CCCACGCGCTCGCCGCAGTCCGG - Intergenic
1038543922 8:28411691-28411713 GCCCCGCGCCGGCCGCCGCCGGG + Intronic
1040688760 8:49910020-49910042 CCCCCGCGCGCGCCGCAGGCCGG + Intronic
1042155622 8:65841674-65841696 CCTCCGCTCGGGCCGCCGGCGGG + Exonic
1048986333 8:139737121-139737143 CCCCTGCGCGGGCCACAGACGGG - Intronic
1054842683 9:69760093-69760115 GCCACGCCCAGGCCGCCAACTGG - Intergenic
1060105511 9:120870374-120870396 CCCACGCACTGGCCCCTGACGGG - Intronic
1060952327 9:127612205-127612227 CCCCCGCGCGCGCCGGCGGCGGG + Intergenic
1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG + Intronic
1186669838 X:11757862-11757884 CCCACGCCCGGGCCGGAGAGCGG + Intergenic
1190304482 X:49074251-49074273 CCCCCGCGCGGGGCGCCGCAGGG + Intronic