ID: 1186204826

View in Genome Browser
Species Human (GRCh38)
Location X:7190389-7190411
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 10, 1: 17, 2: 13, 3: 26, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186204826 Original CRISPR CTGTAAATACAGATGAAGCT TGG Intergenic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
907766574 1:57418456-57418478 TTGTAAATCAATATGAAGCTCGG + Intronic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
907816145 1:57919969-57919991 CTATAAATCCAGATTAGGCTGGG - Intronic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
916407162 1:164508906-164508928 TCTTAAATTCAGATGAAGCTGGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920918205 1:210275800-210275822 GTGTAAATACATGTAAAGCTGGG - Intergenic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1067345170 10:45433057-45433079 CTCTAACTACAGGTGAAGTTAGG - Intronic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1068388617 10:56362554-56362576 CTATAAATACTGCTGAAGTTTGG - Intergenic
1069848317 10:71388523-71388545 GGGTAAATACAAATGAATCTTGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070769965 10:79076495-79076517 CTGTAAAGACACATGCTGCTGGG - Intronic
1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG + Intergenic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1085751914 11:79169159-79169181 CTGTTAATCTAGATAAAGCTTGG - Intronic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086436223 11:86783540-86783562 GGGAAAATACAGATGCAGCTTGG - Intergenic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099111374 12:78565896-78565918 CTATACATACTGATGTAGCTTGG - Intergenic
1100032702 12:90212501-90212523 CTGGAAAGAAAGATGAAACTTGG - Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106553688 13:30792346-30792368 CTGTACATAAAGATGACACTGGG + Intergenic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG + Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1122078579 14:99251596-99251618 CTGTAAATTCAGGTGCACCTGGG - Intronic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1130278242 15:82495020-82495042 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130470571 15:84222205-84222227 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130478059 15:84336772-84336794 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130493706 15:84451358-84451380 CTGTAAATAAAAATGTAGATCGG - Intergenic
1130592858 15:85226831-85226853 CTGTAAATAAAAATGTAGATTGG + Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142956864 17:3528547-3528569 CTGTAAATATAGAACTAGCTGGG - Intronic
1144082545 17:11777989-11778011 ATGTAAAGAGACATGAAGCTGGG + Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445693 18:25910976-25910998 CCATAAATACAGATCAAGGTGGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157350101 18:46876379-46876401 CTGTAAATAAAAATGTAGATTGG + Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
925682610 2:6438712-6438734 CAGTAAATACAGATGCCACTTGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
936750039 2:115631014-115631036 CTGTAAATACATCTGATCCTGGG + Intronic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
944361086 2:198857581-198857603 CTGTAAATGTAGATGAAATTAGG + Intergenic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
1169148747 20:3272522-3272544 CTGAAAATCCTAATGAAGCTGGG - Intronic
1170688673 20:18592313-18592335 CTTGAAATACAGATTTAGCTGGG + Intronic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175106539 20:56619074-56619096 TTTTAAATAGAGATGAGGCTGGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1181375966 22:22458294-22458316 CTGTAAATAAAAATGTAGATTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
954586610 3:51742044-51742066 CTGTAAATAAAAATGTAGATTGG + Intergenic
954663913 3:52240400-52240422 CAGTAAATGGAGCTGAAGCTGGG - Intergenic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
957989068 3:87608151-87608173 CTGTAAATAAAAATGTAGATTGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
959409428 3:106001819-106001841 CTGTTAATACAGATCAAGTAGGG - Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG + Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971980474 4:33743742-33743764 CTGTAAATTCAGATGTTGGTTGG - Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
987160173 5:15133478-15133500 CTGTCATTAGAGCTGAAGCTAGG - Intergenic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989153706 5:38324432-38324454 CTGTAAATACAGCTTCAGATGGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000362572 5:160461595-160461617 TTGTAAATACAGGTAAAACTTGG + Intergenic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG + Intronic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004765173 6:18718278-18718300 CTTTAGATGCAGATAAAGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1007438131 6:41832375-41832397 CAGTACATACATATGTAGCTAGG - Intronic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1013634393 6:112015577-112015599 CTATAAAGAGAAATGAAGCTGGG + Intergenic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027878631 7:83803015-83803037 CTATAAATTCAGATAAAGTTTGG + Intergenic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037355950 8:18019726-18019748 GTTTAAATAAAGGTGAAGCTTGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1057238637 9:93388606-93388628 CTGTAAAGACATATGATGTTGGG + Intergenic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic