ID: 1186209495

View in Genome Browser
Species Human (GRCh38)
Location X:7234477-7234499
Sequence CAGAGCAAATAAAAGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 362}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186209495 Original CRISPR CAGAGCAAATAAAAGGGTGG TGG Intronic
902801523 1:18832978-18833000 CAGAAAAAAAAAAAGAGTGGGGG - Intergenic
904668091 1:32139646-32139668 ACAAGCAAATAAAAGGGTTGGGG + Intronic
905336527 1:37248357-37248379 CACAGCAAGTAAAGGGTTGGTGG - Intergenic
905479318 1:38250272-38250294 CAGTGAAAATAAGAGGGTGGAGG + Intergenic
906547140 1:46627815-46627837 CAAAAAAAAAAAAAGGGTGGGGG - Intergenic
908152592 1:61318580-61318602 CAGAGCAACTATATGGGTGTTGG - Intronic
908573671 1:65436908-65436930 CAGAGGAAATGAAAGTGTTGAGG - Intronic
908680494 1:66655407-66655429 TAGAGCAAATAAAGGGGTTCAGG - Intronic
911331945 1:96534751-96534773 CAGAGAAATTCAAAGAGTGGAGG + Intergenic
911404753 1:97422625-97422647 CTGAGCACATGACAGGGTGGTGG + Intronic
912515197 1:110212469-110212491 CAGACCAAAGAAGGGGGTGGAGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
914046378 1:144096676-144096698 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
914131732 1:144864010-144864032 AAAAGAAAAAAAAAGGGTGGGGG + Intergenic
915660087 1:157398073-157398095 AAGAATAAATAAAAGGGAGGGGG - Intergenic
915890904 1:159772880-159772902 CAGAGAAATTAAGAGGATGGGGG - Intergenic
916997163 1:170313378-170313400 CAAAGTAAATAAAAGGATAGAGG - Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918882561 1:190144186-190144208 GAGAGGAAATAAAAAGGGGGAGG - Intronic
919501891 1:198347776-198347798 ATTAGGAAATAAAAGGGTGGAGG + Intergenic
920098716 1:203503232-203503254 GAGATAAAATAAAATGGTGGAGG - Intronic
920877102 1:209846677-209846699 CAAAGCATATATAAGGGAGGAGG + Intronic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921106533 1:211986353-211986375 TAGAGCAAATAAAAAGGTCATGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922667511 1:227485326-227485348 CATAGAAAATAAAATAGTGGGGG + Intergenic
923476553 1:234338125-234338147 AACAGCAAACAAAACGGTGGAGG + Intergenic
923523406 1:234753836-234753858 CAGAACAATTAAAAGGGGGCAGG - Intergenic
924898940 1:248373659-248373681 CAGAGCAAGTAAGGGGGTGCTGG - Intergenic
1065314688 10:24451755-24451777 AAGAGCAAAGAAAAGGGATGTGG - Intronic
1067020203 10:42789992-42790014 TAGAGCAAGTCAGAGGGTGGTGG + Intronic
1067035296 10:42911309-42911331 GAGATCAAGGAAAAGGGTGGTGG + Intergenic
1067499931 10:46794395-46794417 TAGAGCAAGTCAGAGGGTGGTGG + Intergenic
1067594702 10:47545930-47545952 TAGAGCAAGTCAGAGGGTGGTGG - Intronic
1067641811 10:48054045-48054067 TAGAGCAAGTCAGAGGGTGGTGG - Intergenic
1067840941 10:49679142-49679164 CTGAGCAAATAAAAGGGAATTGG + Intergenic
1069376944 10:67802522-67802544 AAGAACAAATAAAATGTTGGGGG - Intronic
1070139052 10:73722883-73722905 TAGAGCAAGTCAGAGGGTGGTGG - Intergenic
1070676158 10:78412918-78412940 CAGAGAAAATAAAAGCTTAGAGG + Intergenic
1071432456 10:85617228-85617250 CAAAAAAAATAAAAGGGGGGGGG - Intronic
1071606637 10:86998049-86998071 TAGAGCAAGTCAGAGGGTGGTGG + Intergenic
1071681333 10:87708510-87708532 CTGAGGAAATACTAGGGTGGGGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1074554132 10:114472670-114472692 CAGAGCAAATAAGGGAGTGAGGG - Intronic
1075846090 10:125545980-125546002 CAGAGCCAATAACTGGGTGCAGG - Intergenic
1076026437 10:127118620-127118642 CAGAGCAAGTAAAAGGGTGTTGG - Intronic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1077727765 11:4692713-4692735 CAGAGGAAAAGAAAGGGTGCTGG + Intronic
1078742711 11:14082077-14082099 CAGAGGAAATAAAATGTTAGGGG + Intronic
1078877095 11:15409887-15409909 CAGAGCATGTCAGAGGGTGGAGG + Intergenic
1079340558 11:19608153-19608175 CAGAGCAAATGAGAGGCTTGGGG + Intronic
1079630819 11:22672568-22672590 CAGAGCACATAATAGGGTGTAGG + Intronic
1080625926 11:34030688-34030710 CATAGCCAATTAAAGGGGGGGGG + Intergenic
1080853615 11:36092701-36092723 CAAAGCAAATAAAAAGGGAGGGG - Intronic
1081472540 11:43389138-43389160 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
1083363345 11:62126580-62126602 AAGAACAAATGAATGGGTGGTGG - Intronic
1083492801 11:63025493-63025515 CAGAGCAAGTGCAAGGATGGAGG - Intergenic
1084554401 11:69867361-69867383 CAGAGGGAAGAAAACGGTGGTGG - Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085556378 11:77426235-77426257 CAGAGAAAAAAAGATGGTGGTGG - Intronic
1085979508 11:81706587-81706609 CACATCAAATAATAGGGTGCAGG - Intergenic
1086376097 11:86202380-86202402 CGGTACAAATAAAAAGGTGGAGG - Intergenic
1087745182 11:101936193-101936215 CAAACCAAAATAAAGGGTGGGGG - Intronic
1088817309 11:113430447-113430469 CAGAGACATTAAAATGGTGGGGG + Intronic
1090197180 11:124826757-124826779 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
1090878644 11:130814013-130814035 CAGATAAAACAAAAAGGTGGAGG + Intergenic
1091422988 12:359741-359763 CAAAAAAAAAAAAAGGGTGGGGG + Intronic
1093765154 12:22953864-22953886 CAGAGCATATAAAAGGGCTGAGG + Intergenic
1094269026 12:28590783-28590805 TAGAGAAAATACAAGGGTGAGGG - Intergenic
1094360863 12:29629360-29629382 CAGAACAACTTGAAGGGTGGAGG - Intronic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097625745 12:61998145-61998167 CAGAGCAAGTAAAAGGAGAGTGG + Intronic
1097744276 12:63284122-63284144 GATAGAAAATAAAAGTGTGGAGG + Intergenic
1097852212 12:64423450-64423472 CAAAGCAAAAAAAAAGGAGGGGG - Intronic
1098198421 12:68027419-68027441 CAGAGAAAATTGAGGGGTGGTGG + Intergenic
1098497469 12:71152846-71152868 GAGAGCAATTAAAAGATTGGAGG - Intronic
1099055909 12:77840394-77840416 AAGAGCCAGTAAATGGGTGGGGG + Intronic
1099522738 12:83683817-83683839 CACTGAAAATAAAAGGATGGAGG + Intergenic
1099702947 12:86112314-86112336 AAAAACAAAAAAAAGGGTGGGGG - Intronic
1100867293 12:98870471-98870493 CAAAGAAAAGAAAAGGGTGAGGG - Intronic
1101381094 12:104214767-104214789 TAGAGTAAAGTAAAGGGTGGGGG + Intergenic
1102204653 12:111082344-111082366 CAGTCCAAATAAAAGGCTGGTGG + Intronic
1102533591 12:113565014-113565036 CAGAGGAGATAAAATGGGGGTGG - Intergenic
1102877633 12:116460127-116460149 CAGAGAAAATTACACGGTGGGGG + Intergenic
1103174781 12:118853384-118853406 CAAACCAAAGAAAAAGGTGGGGG + Intergenic
1105405774 13:20131427-20131449 CAAAGCAAATTAAAGAGGGGAGG - Intergenic
1106769643 13:32949353-32949375 CAGAGAACAGAAAAGGGCGGGGG + Intergenic
1107165123 13:37274694-37274716 CAGAGAAAATAAATTGATGGTGG + Intergenic
1107223964 13:38023723-38023745 AGAAGCAAATAAAAGAGTGGGGG - Intergenic
1108000289 13:45900027-45900049 CAGAGAAAATGAAAGGGTTAAGG + Intergenic
1108672799 13:52708966-52708988 CAGACCAAAAGAAAGGGGGGAGG - Intronic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1110571610 13:77010876-77010898 TGGAGCAAATAAATGGGTGTTGG + Intronic
1112359908 13:98708075-98708097 CAAAGATATTAAAAGGGTGGGGG + Intronic
1113416538 13:110132736-110132758 CAGAGCTCAGCAAAGGGTGGGGG + Intergenic
1114255836 14:21000823-21000845 CAGAACACAAAAAAGGGTAGGGG - Intronic
1116049343 14:39784220-39784242 CAAAGCAAATAAGGGGGCGGGGG - Intergenic
1117458925 14:55925765-55925787 CAGAAAGAATAAAGGGGTGGAGG - Intergenic
1118372427 14:65148961-65148983 TAGATGAAATGAAAGGGTGGAGG - Intergenic
1118460341 14:65981339-65981361 CAGGGCAGACAAAAGGGTGTTGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120012689 14:79435268-79435290 CAGGGCAAAAGAAAGGGAGGAGG + Intronic
1120508570 14:85383725-85383747 AGGAGCAATTAAAATGGTGGTGG + Intergenic
1121720033 14:96102914-96102936 CATAGCCAATACAAAGGTGGGGG - Intergenic
1122547943 14:102535057-102535079 CAGAGAAAAAAAAAAGGGGGGGG + Intergenic
1122778095 14:104131649-104131671 CAGAGCAGAATATAGGGTGGGGG + Intergenic
1123705019 15:22944953-22944975 CAGGGCAAATCAAAGGCAGGCGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126884337 15:53133668-53133690 CAGAGCTAATAAATGTCTGGTGG - Intergenic
1127197967 15:56610569-56610591 AAGAGCAGAGAAAAGGTTGGGGG - Intergenic
1127438760 15:58985493-58985515 CAGATGAAATAAAAGGGTGAGGG - Intronic
1128066107 15:64765578-64765600 CAGAATAAAAAAAAGGGCGGGGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1131338384 15:91572234-91572256 CAGAGGGAATAAGAGGCTGGAGG + Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1131823879 15:96300864-96300886 AGGAGCAAATAAAATGGTGTTGG - Intergenic
1132377642 15:101340829-101340851 CCCAGAAAATGAAAGGGTGGTGG - Intronic
1134544797 16:15099598-15099620 CAGAGAAAATAAAGGGGGTGGGG + Intronic
1135362425 16:21826316-21826338 CAGAGAAAATAAAGGGGGTGGGG + Intergenic
1135426496 16:22341360-22341382 CAGGAAAAATAAAAGGCTGGTGG + Intergenic
1135458685 16:22622057-22622079 CAGAGTAAATAAAAGCGTGAGGG - Intergenic
1135761300 16:25140368-25140390 CAGGGCAAAAAAAAAGTTGGTGG - Intronic
1136243367 16:28958486-28958508 TAGAACAAAGAAAGGGGTGGTGG - Intronic
1137018542 16:35399378-35399400 CAGATCACATAAAATGGGGGTGG + Intergenic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1137935746 16:52633757-52633779 TAGAGCAAATCACAGTGTGGTGG + Intergenic
1138346332 16:56322519-56322541 CAGCACAAAAAAAAGGATGGTGG - Intronic
1138602354 16:58063614-58063636 CAGAGGAAAGAAGGGGGTGGGGG - Intergenic
1139916016 16:70428894-70428916 CACAGGATGTAAAAGGGTGGGGG + Intronic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1142083298 16:88162671-88162693 CACAGAGAATAAAAGGGGGGGGG - Intergenic
1142693640 17:1621524-1621546 CAGAGCAAACAACAGGCAGGAGG + Intronic
1142722244 17:1784272-1784294 CAGAACAAATAAAAGGGAAGGGG + Intronic
1144127312 17:12215167-12215189 GAGAGAAAGTAAAGGGGTGGGGG + Intergenic
1144542172 17:16155004-16155026 CAGAAGAAAGAAAAGGGTGATGG - Intronic
1145271768 17:21408754-21408776 CTGAGCAGATAAATGGGTGGGGG - Intronic
1145309982 17:21696218-21696240 CTGAGCAGATAAATGGGTGGGGG - Intronic
1146436507 17:32853963-32853985 AAGAGGAAATAAGAGGTTGGGGG - Intronic
1146712775 17:35056896-35056918 AAGAAAAAAAAAAAGGGTGGTGG - Intronic
1146841182 17:36155368-36155390 CAGGGGAAAAAAAAGGGTGGGGG + Intergenic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1148489025 17:48011601-48011623 GAAAGAAAAGAAAAGGGTGGAGG + Intergenic
1149499255 17:57138997-57139019 AAGGGAAAATTAAAGGGTGGTGG - Intergenic
1150082684 17:62254313-62254335 CAGGGAAAAAAAAGGGGTGGGGG + Intergenic
1150303457 17:64064893-64064915 TAGAGAAACTAACAGGGTGGAGG + Intronic
1150519501 17:65851723-65851745 GAGATTAAATATAAGGGTGGTGG + Intronic
1153455798 18:5280825-5280847 CAGAGCAAGTAGGAGGGAGGAGG - Intergenic
1153515624 18:5898053-5898075 TAGAGCAAATGAAAGGTTGCAGG - Intergenic
1153656417 18:7286742-7286764 CAGAACAAATAAAAAGATGAAGG - Intergenic
1153660308 18:7320064-7320086 GAGGGCAAATAAAATGGGGGGGG + Intergenic
1155170444 18:23263212-23263234 CAGAGCCACTAACATGGTGGAGG + Intronic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1156090820 18:33466631-33466653 CAGAGCAGGAAAAAGGGGGGTGG - Intergenic
1156520983 18:37722152-37722174 CTGAGCCAGTAAAAGGGTGGGGG + Intergenic
1157342632 18:46792768-46792790 CAAAGGAAATAAATTGGTGGTGG + Intergenic
1158070641 18:53466234-53466256 CAGAGCATTTAAAAGTGTGTGGG - Intronic
1158399579 18:57109833-57109855 CAGAGGAAATAATGGGGTGCTGG - Intergenic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1158751884 18:60271424-60271446 CAGAGGGAATAAAATGGTGAGGG + Intergenic
1159308351 18:66675122-66675144 CATAGCAAAAAAAAGGGAGATGG - Intergenic
1161952321 19:7474788-7474810 TGGAGCAAATCAGAGGGTGGGGG - Intergenic
1162322559 19:9978767-9978789 GAAAGCAAAAAAAATGGTGGAGG - Intronic
1162999866 19:14360226-14360248 CAGAGCTCAGAAAAGGGTTGGGG - Intergenic
1165704706 19:37967249-37967271 CAAAAAAAAAAAAAGGGTGGGGG - Intronic
1165736484 19:38179603-38179625 CAGAGCACAAAAAAGGGAGAAGG - Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166424140 19:42661222-42661244 CAGAGAAAACAACTGGGTGGTGG + Intronic
1167490532 19:49790424-49790446 CCAAACAAAAAAAAGGGTGGGGG - Intronic
1168259819 19:55187042-55187064 CAAAGAAAAAAAAAAGGTGGGGG + Intronic
1168343959 19:55641452-55641474 CAGAGCAAAAGAACGGGCGGGGG + Intronic
1168371758 19:55841174-55841196 TAAAGCAAATAACAGTGTGGCGG - Intronic
1168713039 19:58512574-58512596 CAGAGCAAGCACATGGGTGGGGG - Intergenic
1202685931 1_KI270712v1_random:50091-50113 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
926388384 2:12361304-12361326 CAGGACAAATAAAAGGCTGAAGG + Intergenic
927140355 2:20126017-20126039 GAGAGCCAATAAAATTGTGGTGG + Intergenic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
933975663 2:87507175-87507197 GAAAGCACATAAAAGGGTTGGGG + Intergenic
935143335 2:100375948-100375970 CACAGAAAAAAAAGGGGTGGGGG + Intergenic
935150979 2:100435567-100435589 CAAAGCAATTTAAAGGCTGGGGG - Intergenic
935208170 2:100914666-100914688 CAGAGAATATAAAAGCCTGGTGG - Intronic
936166661 2:110126551-110126573 CACAGCAGTTAATAGGGTGGAGG - Intronic
936318161 2:111443638-111443660 GAAAGCACATAAAAGGGTTGGGG - Intergenic
936452178 2:112641995-112642017 CAGAGTTAATAAAAAGGAGGGGG + Intergenic
936835960 2:116709825-116709847 CAAAGCACCTAAAAGGGTGGAGG - Intergenic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
938848900 2:135239982-135240004 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
940846701 2:158650180-158650202 CAGAGCTAATAAAAGGGAACAGG - Intronic
942170401 2:173283829-173283851 CAAAACAAAGAAAAGGGTTGGGG - Intergenic
942650158 2:178158082-178158104 AATAGCAAAGAAAAGGGTGGTGG - Intergenic
943031841 2:182694808-182694830 TAGAGGAAAAAAAAAGGTGGGGG + Intergenic
943620462 2:190142474-190142496 CTGAGCTAATCAAAGAGTGGTGG - Intronic
944184842 2:196936371-196936393 AAGAGATAAAAAAAGGGTGGGGG + Intergenic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
945087283 2:206145180-206145202 CAGGGCAAAAAAAAAGGTGGGGG - Intronic
945848646 2:214979247-214979269 TAGAGCAAATGAGAGGGAGGGGG - Intronic
945910430 2:215642941-215642963 CACAGCAAGTGAAAGTGTGGTGG + Intergenic
947489051 2:230578281-230578303 AAGAGCAAATAAAAAATTGGTGG - Intergenic
1170250665 20:14277599-14277621 TATATCAAAGAAAAGGGTGGTGG + Intronic
1170274517 20:14569566-14569588 AAGAGAAAAAAAAAAGGTGGGGG - Intronic
1171569055 20:26228952-26228974 CTGAGTAAATAAAAGGGTTTGGG + Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1173598794 20:44278217-44278239 CGGAGCAACTGCAAGGGTGGAGG + Intronic
1174334880 20:49852830-49852852 CAAAACAAACAAAAGGCTGGGGG - Intronic
1175835824 20:61993692-61993714 TGGGGCACATAAAAGGGTGGGGG + Intronic
1177386610 21:20417616-20417638 CAGAGAAAATAAAGCAGTGGAGG - Intergenic
1177500626 21:21950062-21950084 CAGACAAAACAAAAAGGTGGAGG - Intergenic
1177890394 21:26797699-26797721 AAGAGAAAAAAAAAGGGCGGGGG - Intergenic
1178452086 21:32711304-32711326 CAGAAAAAAGAAAAAGGTGGAGG - Intronic
1178477997 21:32954797-32954819 GAGAGAAAAAAAAAGGGAGGGGG - Intergenic
1180225131 21:46387639-46387661 CTGGGCAAATAACAGGGAGGGGG - Intronic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1182786997 22:32916299-32916321 GAAAGCAAATAAAATGGTTGTGG + Intronic
1183123602 22:35752737-35752759 CAAAGGAAAGAAAAGGCTGGTGG - Intronic
1184373883 22:44099522-44099544 AATAGCAAAAAAAAAGGTGGGGG - Intronic
949294452 3:2504871-2504893 AAGAGACAATAAAAGGTTGGGGG + Intronic
950693182 3:14677266-14677288 CAGTGCCAGTAAAGGGGTGGAGG + Intronic
951242873 3:20307272-20307294 CAGAGTTAATAAAAGAGAGGAGG + Intergenic
951441314 3:22727060-22727082 CTGAGGAAATAAAAGGAGGGAGG - Intergenic
951486340 3:23215701-23215723 AACAGCAAAGAGAAGGGTGGTGG - Intronic
951955666 3:28250539-28250561 CAGAAAGAAGAAAAGGGTGGTGG - Intronic
952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG + Intergenic
953014190 3:39056974-39056996 CTGAGAAAATAAAGGGGTGGGGG + Intronic
953552784 3:43917411-43917433 AACAGCATATAGAAGGGTGGGGG - Intergenic
953572953 3:44087005-44087027 TAGAGCCAATAAGAGGGTGTGGG - Intergenic
953857387 3:46509970-46509992 CAGACAGAATAAAATGGTGGAGG - Intergenic
954085423 3:48240360-48240382 CAGGGCAAAGAAAAGGACGGCGG + Intergenic
954225523 3:49178400-49178422 CAGAGCAGATGGTAGGGTGGAGG - Intronic
954689037 3:52386112-52386134 CAGAGAAGAGAAAAGGGGGGAGG + Intronic
955117197 3:56017539-56017561 GAGAGCAAGTACAAGGGTGTGGG - Intronic
955551067 3:60086140-60086162 GAGAGAGAGTAAAAGGGTGGGGG + Intronic
956388231 3:68743773-68743795 CAGAGTTAGTAAAGGGGTGGAGG + Intronic
957649259 3:82978345-82978367 AAAAGAAGATAAAAGGGTGGTGG - Intergenic
958003755 3:87785953-87785975 GAGAGCAGATAAATGAGTGGTGG + Intergenic
958564476 3:95791222-95791244 CAGATAGAATAAAAAGGTGGAGG - Intergenic
958832230 3:99103397-99103419 CATAGTAAATAAAAGGGAGGTGG + Intergenic
959340463 3:105123197-105123219 AAGGGAAAATAAAAGGGTGAGGG + Intergenic
961065158 3:123869221-123869243 CAGAACACATGAAAAGGTGGTGG + Intronic
962162602 3:133014578-133014600 CAGAGCAGAGGCAAGGGTGGTGG - Intergenic
962920335 3:139944526-139944548 CAGAGAAAATAAAGGACTGGTGG - Intronic
963064670 3:141253822-141253844 CAGAGGAGATAAAAAGGTTGAGG - Intronic
963251545 3:143108762-143108784 CAGAGCCAATAAAAGCCTGTTGG + Intergenic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
963669311 3:148231836-148231858 CAGAGCAACTCAAAGTGGGGCGG + Intergenic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
966507778 3:180726417-180726439 TAGAGAAAGTAAAAGGGCGGGGG + Intronic
967456483 3:189692447-189692469 CATAGTAAATAAAAGTGGGGAGG - Intronic
969454892 4:7295150-7295172 GGGAGAAAATAAAAGGGAGGAGG - Intronic
971454980 4:26835708-26835730 CAGGGCAAAGAATAGGGTGAAGG - Intergenic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
971914018 4:32843677-32843699 AAGAGCAAGAAAAAGGATGGAGG + Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973755210 4:54067355-54067377 CAGAGCCAGCAAAAGGGTGTGGG + Intronic
974946386 4:68534300-68534322 CAAAACAAATAAAGGGATGGAGG - Intergenic
975607401 4:76168869-76168891 GAGAGCTAAGAAGAGGGTGGTGG + Intronic
976072597 4:81258933-81258955 TAGGGCAATTAAAAGGGTAGTGG - Intergenic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977034249 4:91929477-91929499 CACAGAGAATAAAAGGGCGGGGG - Intergenic
977654253 4:99503798-99503820 CCCAGTAAATAAAATGGTGGGGG - Intergenic
979338665 4:119493465-119493487 TAGAGAAAATAAAAGGTAGGGGG - Intergenic
979362472 4:119781117-119781139 TAGAGCAAATAAAAAGATGGGGG + Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980402755 4:132313877-132313899 CAGATAAAATAAAAAGGTGGAGG - Intergenic
982753163 4:159187297-159187319 CAGAGAAAAAAAAGGGGAGGAGG - Intronic
983160914 4:164413191-164413213 CAGACCAAAAAAAAAGGGGGGGG + Intergenic
983507639 4:168572485-168572507 CAGAGCAAATCAAAAGGTGGAGG - Intronic
984147199 4:176077200-176077222 CTGAGTAAATATAAGGGCGGGGG + Intronic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984631458 4:182065486-182065508 GAGAGCAAAGATAAGGGAGGAGG + Intergenic
985346625 4:189012168-189012190 GGGAGAAAATATAAGGGTGGCGG + Intergenic
986519609 5:8600219-8600241 CAGAGCAGAAAAGAGGGTGAAGG - Intergenic
986574669 5:9199344-9199366 CACAGCAAGTGAAAGGGTAGAGG - Intronic
987128761 5:14841117-14841139 CTGAGCAAAAAAATGGGTAGAGG + Intronic
987306387 5:16641460-16641482 CAGAGGAACTTAAGGGGTGGTGG + Intergenic
987447134 5:18034083-18034105 CACAGAGAATAAAACGGTGGTGG - Intergenic
987554357 5:19428036-19428058 CAGAATATATAAAACGGTGGTGG - Intergenic
988276347 5:29085585-29085607 CAGAGGAAATAGGAGGGAGGGGG + Intergenic
989085674 5:37673589-37673611 GAAAGAAAAAAAAAGGGTGGGGG - Intronic
990154236 5:52856606-52856628 CAGAGGAGGTAGAAGGGTGGTGG - Intronic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990620872 5:57557254-57557276 CACTGCAACTAAAAAGGTGGAGG - Intergenic
991083257 5:62624021-62624043 CAAAACAAAAAAAACGGTGGGGG - Intronic
991565003 5:67996291-67996313 TATAGCAAAAAAAAGGGGGGGGG + Intergenic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
992403192 5:76430192-76430214 CTGTGCAAATAAGATGGTGGTGG - Intronic
993225710 5:85165709-85165731 CAGAGCAACCAAGATGGTGGTGG - Intergenic
993453531 5:88101106-88101128 CAGAGGAGAGAAAAGGGTGGGGG - Intergenic
993767519 5:91879363-91879385 CTGAGGGAAAAAAAGGGTGGGGG - Intergenic
995911503 5:117193196-117193218 AAGAGCAAATAAGAGAGTGGGGG - Intergenic
997473142 5:134127803-134127825 CAGAGGAAATCAAGGGCTGGCGG + Intronic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
997866449 5:137467799-137467821 CTCAGCAAATGGAAGGGTGGAGG + Intronic
998490673 5:142543815-142543837 GAGAGGAAATAAAGAGGTGGAGG - Intergenic
999729164 5:154462833-154462855 AAAAGAAAATAAAAGGGTGTTGG - Intergenic
1000747370 5:165050838-165050860 CAAAACAAGTAAAAGGATGGTGG - Intergenic
1001080270 5:168662451-168662473 CAGAGGGAAAAAAAAGGTGGGGG - Intronic
1001264753 5:170265795-170265817 CATAGCCAAGAAAGGGGTGGGGG + Intronic
1001363866 5:171117320-171117342 AAGAGCAAAAAAAATGCTGGTGG - Intronic
1001666259 5:173435891-173435913 CAGAGCAAAAAAGAGGGTGGAGG - Intergenic
1001769640 5:174283647-174283669 AAGAGCTAATAAAAGGAGGGAGG + Intergenic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1004145734 6:13064340-13064362 CTGAGCAATTAAATGGATGGAGG + Intronic
1004635505 6:17463987-17464009 AAGAGCAAATTAATGGTTGGCGG + Intronic
1006246825 6:32744422-32744444 CAGAGGAAAAAAAAAAGTGGGGG + Intronic
1006525212 6:34598642-34598664 CAAAGCAAATAAAATGGAGCTGG + Intronic
1006750270 6:36372660-36372682 CTGAGCAATTGGAAGGGTGGAGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008417650 6:51261578-51261600 CAGGGCAAGAGAAAGGGTGGAGG + Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1008997092 6:57672081-57672103 CAGAGCAAATAACCGTTTGGAGG - Intergenic
1011876072 6:91964122-91964144 CAAAGTAAATAAAAGGTTGTTGG + Intergenic
1012362311 6:98397801-98397823 AAGAGAAAAAAAAAGGGGGGGGG - Intergenic
1012578478 6:100832769-100832791 CAGACAATATAAAAGGGTAGGGG + Intronic
1013521792 6:110940163-110940185 TAGAGCAAATAAAATGGTATAGG + Intergenic
1013936514 6:115602513-115602535 CAGAGCATATACAAGGGGCGAGG - Intergenic
1014192161 6:118508933-118508955 GAGAGCCAATAAAATGGTGAGGG - Intronic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014978077 6:127913903-127913925 AACAGCACATAAAATGGTGGAGG + Intronic
1016323193 6:142870496-142870518 GAGAGTAAATAAAAGGGGGCAGG - Intronic
1017085238 6:150707461-150707483 CAGATCATATAAAGGAGTGGCGG + Intronic
1017327458 6:153155757-153155779 CATAACAAATAAGAAGGTGGTGG + Intergenic
1017616859 6:156255202-156255224 CAGTGGAAATAAAATGGGGGAGG - Intergenic
1018979014 6:168588112-168588134 CAAAACAAAAAAAAGGGTGAGGG - Intronic
1020206361 7:6120257-6120279 CAGAGCAAATAAAAAGGGCCGGG - Intronic
1020844612 7:13267358-13267380 CAGAACTAAAAAAAGGGTGTTGG + Intergenic
1021348703 7:19561224-19561246 CACAATAAATAAATGGGTGGAGG - Intergenic
1021826806 7:24561622-24561644 AAGAACAAACAAATGGGTGGGGG - Intergenic
1022029175 7:26476658-26476680 AAGAGAAAAAAAAAGGGGGGAGG - Intergenic
1022315396 7:29240693-29240715 CAGACCAAAGATGAGGGTGGGGG + Intronic
1023093317 7:36636221-36636243 GAGAGCAAATAAATTGGTGGAGG + Intronic
1023883793 7:44336304-44336326 AAGAGCAAGTAAAGGGGCGGGGG + Intergenic
1023977440 7:45041227-45041249 CAAAGCAAATAGAGGTGTGGAGG + Intronic
1024869428 7:53945151-53945173 AAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1028444074 7:90899174-90899196 CAGAGCAAATAAAAGACAAGTGG - Intronic
1028620355 7:92820037-92820059 CCCAGCAAATTAAATGGTGGCGG + Intronic
1030579681 7:111338325-111338347 CATAGCAAAAAAAGGGGGGGAGG - Intronic
1030741369 7:113113804-113113826 CCGAAAAAAAAAAAGGGTGGGGG + Intergenic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1031859578 7:126962785-126962807 CAGAGCAAATATGTGGGTTGTGG - Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032605915 7:133352914-133352936 CAGAGCCATTAAAGGAGTGGAGG - Intronic
1032741466 7:134743448-134743470 CTGAGCAAATCTAAGGGGGGTGG + Intergenic
1033120027 7:138659543-138659565 CAGGACAACTCAAAGGGTGGGGG - Intronic
1033387335 7:140891150-140891172 CAGAGAAAATGAGAGGGTGTGGG + Intronic
1033672524 7:143506567-143506589 CAGAGCAAATAAATGAGAGCTGG + Intergenic
1035477401 7:159152973-159152995 CAGAGGAAACAAAAAGGTAGAGG - Intergenic
1036623692 8:10446532-10446554 CAGACCAAAAAAAAGGCGGGGGG + Intergenic
1037308770 8:17533102-17533124 GAAAGCAATTAAAAGGGTGCTGG - Intronic
1043303065 8:78759062-78759084 CAGATTAAAAAAAAAGGTGGGGG - Intronic
1043404750 8:79918798-79918820 AAGAGCAAAACAAGGGGTGGGGG + Exonic
1043817697 8:84823412-84823434 GAGAGGAAATAAAAGGCTGCAGG + Intronic
1044227453 8:89735964-89735986 CTGAGCAAATACAGGGGTAGAGG + Intergenic
1044539563 8:93394126-93394148 AAAAGAAAAAAAAAGGGTGGGGG - Intergenic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1044878174 8:96693652-96693674 CAGACCAAAAAAAAGGCTGAGGG + Intronic
1045687464 8:104726989-104727011 CAGAGGACAGAAAAGGGTGGAGG - Intronic
1046230295 8:111347231-111347253 CAGAGTAAATGAAGTGGTGGAGG - Intergenic
1046394397 8:113622815-113622837 AAGAGCAAATAAAAGGACAGTGG + Intergenic
1047498959 8:125428075-125428097 CAGAGAAACTACAAGGGTGGTGG - Intergenic
1047866625 8:129031419-129031441 CAGAGCAAAAAAAAAGGAGGAGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048856870 8:138693703-138693725 CACAGGAAATAAAAGAGGGGCGG + Intronic
1050689168 9:8205807-8205829 AAGGATAAATAAAAGGGTGGAGG - Intergenic
1051126802 9:13814004-13814026 CTGAGCAAATAAGAGGGTGTTGG + Intergenic
1051506656 9:17834544-17834566 GAGAGGAACTAAAAGGGTGAAGG + Intergenic
1051744635 9:20283738-20283760 AAGAGAAAAAAAAAGGGGGGGGG + Intergenic
1051810971 9:21049155-21049177 CAGATGGAATAAAAAGGTGGAGG - Intergenic
1052298346 9:26924495-26924517 AAGAGGAAATAAAGGGTTGGAGG - Intronic
1053329501 9:37190236-37190258 CTGAGCAAACAAGATGGTGGTGG - Intronic
1059363383 9:113765865-113765887 AAGAGAAAGGAAAAGGGTGGTGG - Intergenic
1061268794 9:129524457-129524479 AAGAAAAAAAAAAAGGGTGGAGG - Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1187634122 X:21207790-21207812 CAGGGCCTATTAAAGGGTGGAGG + Intergenic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1189881943 X:45503229-45503251 AAGAACAAATAAGAGGGTTGAGG - Intergenic
1190099259 X:47508452-47508474 AAGAGAAAATAAAATAGTGGAGG + Intergenic
1190384657 X:49873160-49873182 GAGACAAAAAAAAAGGGTGGGGG - Intergenic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1191939395 X:66462057-66462079 CAGAGTAAATGAAATGGTGGGGG + Intergenic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1193661220 X:84260945-84260967 CAGACCTAATGAAAAGGTGGAGG + Intergenic
1194027324 X:88769446-88769468 CAGAGCCAATAAAAGTCCGGTGG + Intergenic
1194407386 X:93513661-93513683 CAGAGCAAATAATGGGGCAGAGG - Intergenic
1195702002 X:107712600-107712622 AAGAGCAAAGGAAAGGGGGGTGG + Intergenic
1195897010 X:109756018-109756040 AAGAGAAAAAAAAAGAGTGGAGG + Intergenic
1198446846 X:136725842-136725864 CACAGGAAAAAAAAAGGTGGAGG + Intronic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1200975908 Y:9211807-9211829 ACGATCAAATAAAAGGGTGGGGG - Intergenic
1201011534 Y:9551754-9551776 CAAAGAAAATAAAAGGGTCCTGG - Intergenic
1202135255 Y:21654724-21654746 ATGCTCAAATAAAAGGGTGGGGG + Intergenic