ID: 1186210458

View in Genome Browser
Species Human (GRCh38)
Location X:7245074-7245096
Sequence TGCTATATGTTGCACTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186210456_1186210458 7 Left 1186210456 X:7245044-7245066 CCTGCTGGCTCTGGCCTTCTCTG 0: 1
1: 0
2: 9
3: 68
4: 567
Right 1186210458 X:7245074-7245096 TGCTATATGTTGCACTCTTATGG 0: 1
1: 0
2: 0
3: 6
4: 90
1186210457_1186210458 -7 Left 1186210457 X:7245058-7245080 CCTTCTCTGATATGAATGCTATA 0: 1
1: 1
2: 4
3: 8
4: 155
Right 1186210458 X:7245074-7245096 TGCTATATGTTGCACTCTTATGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186210458 Original CRISPR TGCTATATGTTGCACTCTTA TGG Intronic
904178411 1:28648011-28648033 TGCTATATGCTGCACTTCGAAGG - Intergenic
904242705 1:29159209-29159231 TGATATATTTTGTACTCATATGG + Intronic
907153317 1:52309077-52309099 TGCAATGTGTTGCTCTGTTAGGG - Intronic
909689068 1:78385667-78385689 TGTTATATATTGCATTATTAAGG + Intronic
912457893 1:109810866-109810888 TTCTGTATGTTGCATTTTTAGGG + Intergenic
913664968 1:121039312-121039334 TGCTATATTTTGGAGTCTTGTGG - Intergenic
914016359 1:143822583-143822605 TGCTATATTTTGGAGTCTTCTGG - Intergenic
914161425 1:145138416-145138438 TGCTATATTTTGGAGTCTTCTGG + Intergenic
914654977 1:149731125-149731147 TGCTATATTTTGGAGTCTTCTGG - Intergenic
917222179 1:172743590-172743612 TGGTAAGTGTTGCTCTCTTAGGG - Intergenic
917430647 1:174964648-174964670 TGCTGTATGTGGGACTATTAAGG - Intronic
919331977 1:196183469-196183491 TCCTATATATTGCTATCTTATGG - Intergenic
921479149 1:215643981-215644003 TGCTAAATGTTGCAGTTTTTTGG - Intronic
924258590 1:242206991-242207013 TTCTATATGTTGCAGTCTTGAGG + Intronic
1062935815 10:1387569-1387591 TAATATATATTGCACTCTTCTGG - Intronic
1068952921 10:62795257-62795279 TGCTAGTTGTTGCACTGCTAGGG + Intergenic
1071862335 10:89686968-89686990 TTCTCTATGTTACACTCCTAAGG - Intergenic
1077562953 11:3276159-3276181 TTCTATATGCTGCATTTTTAGGG - Intergenic
1077568846 11:3321975-3321997 TTCTATATGCTGCATTTTTAGGG - Intergenic
1081018310 11:37909661-37909683 TGATCTGTGTTGCACTCTTGTGG + Intergenic
1086273672 11:85097890-85097912 TGCAATATTTTGCCCTCTTTAGG + Intronic
1086560600 11:88164179-88164201 CTCTAAAAGTTGCACTCTTAAGG + Intronic
1088182148 11:107124914-107124936 TGCTATAAATTTCCCTCTTAAGG - Intergenic
1094617385 12:32048007-32048029 TGTAATATGCTGCACTCTGAAGG - Intergenic
1095950298 12:47778115-47778137 TGATATTTGTTCCACTCTTTGGG + Intronic
1099209844 12:79771112-79771134 TGCTATATTTTTCCTTCTTAGGG - Intergenic
1101046847 12:100815475-100815497 TGTTATATGTTACACGCTTATGG - Intronic
1104194741 12:126524392-126524414 TTCTATATGCTGCATTTTTAGGG - Intergenic
1109490712 13:63096307-63096329 TGAAATATTTTGCACTTTTAGGG + Intergenic
1110307652 13:74008475-74008497 TGCAATATGATGAATTCTTATGG + Intronic
1120619299 14:86743695-86743717 TGTTTTCTGGTGCACTCTTAAGG + Intergenic
1120655695 14:87187384-87187406 TGTCATTTGCTGCACTCTTATGG - Intergenic
1126466111 15:48962956-48962978 TGCTGTATGTAGGACTCTTCGGG - Exonic
1128170462 15:65507446-65507468 TGCAATATTTTGCACTCTATGGG + Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1130668473 15:85889721-85889743 TGCTATTTCTTGCTCTCTTTTGG - Intergenic
1137340539 16:47598868-47598890 TTCTATATGCTGCATTTTTAGGG + Intronic
1140015025 16:71174433-71174455 TTATCTGTGTTGCACTCTTATGG - Intronic
1143199529 17:5102727-5102749 GGCTTTATGTTGCAATGTTACGG - Intergenic
1146646119 17:34578716-34578738 TGATCTAGGTTGCACTCTAATGG + Intronic
1149662252 17:58340213-58340235 TGCTATAGGTTGCACCAATAAGG - Intergenic
1153106381 18:1533009-1533031 CGTTATCTGTTGCACTCTTTGGG + Intergenic
1153528318 18:6018280-6018302 TGGTATATTTTTCACTTTTAGGG - Intronic
1155101645 18:22616330-22616352 TGCTTCATCTTGCACTTTTATGG - Intergenic
1165054464 19:33165377-33165399 TGCTATATATTGTATTATTATGG - Intronic
928529151 2:32173117-32173139 TGTTATAAGTTCCACTCTCAGGG + Intronic
933045099 2:77525701-77525723 TTCTATATGTTGCACACTTCTGG + Intronic
939116301 2:138065204-138065226 TGCTAAATGTGCCACTTTTATGG + Intergenic
942799402 2:179859780-179859802 TGCTGTATTTTGCATTCTAAAGG + Intronic
943558061 2:189429064-189429086 GGCAATATGTTGCACTCTTGAGG + Intergenic
948418679 2:237838201-237838223 ATCTAACTGTTGCACTCTTAAGG - Intronic
1169702079 20:8458023-8458045 TGCTCTTTGTTTCACTCTAAAGG - Intronic
1175720713 20:61285321-61285343 TGCTCTATGCTACACTCCTATGG - Intronic
1175720723 20:61285386-61285408 TGCTCTATGCTACACTCCTATGG - Intronic
1176207315 20:63895890-63895912 TGCTTTATATTGAACTCTTAAGG + Intronic
1182203132 22:28593916-28593938 TGAGGTATTTTGCACTCTTAAGG + Intronic
1184836479 22:47025621-47025643 TGCTATAGGTTTCCCTCTAAGGG - Intronic
949918096 3:8980728-8980750 TGATAAATGTTGCCCTCTTCTGG - Exonic
950205845 3:11079976-11079998 TGCTATATGTTACCTTATTAGGG - Intergenic
953659586 3:44882380-44882402 TGCTGTATGTTGGTTTCTTAGGG + Intronic
955350744 3:58191389-58191411 TGCTATATTTTGTATTTTTAAGG + Intergenic
957502485 3:81075155-81075177 TGGTATAAGTTGCAGTCTGAGGG - Intergenic
958070250 3:88601165-88601187 TTCTATATGCTGCATTTTTAGGG - Intergenic
958124957 3:89343968-89343990 TGCTATATATTGCATGATTATGG + Intronic
958268665 3:91470844-91470866 TAATATATGTGGTACTCTTAGGG - Intergenic
959988414 3:112602780-112602802 TGCTTTACTTTGCACTTTTATGG - Intergenic
962255225 3:133865819-133865841 TGTTATGTGGTGCACTCTTGAGG - Intronic
964985168 3:162729128-162729150 TGCAATATTTTGCAATCTTTGGG + Intergenic
966814965 3:183882906-183882928 AGCTATATGTTGACTTCTTATGG - Intronic
978889280 4:113803495-113803517 TGCAATACATTGCACTCCTATGG + Intergenic
980252319 4:130334137-130334159 TCCTATATCCTGCACTCTTATGG - Intergenic
982157027 4:152534005-152534027 TGCTCTATGTTTAACCCTTAAGG + Intronic
986966658 5:13280992-13281014 TGCAATATTTACCACTCTTATGG - Intergenic
989758852 5:44988154-44988176 AGCTATATTTTGCACTGTGAAGG + Intergenic
990352027 5:54928268-54928290 TGCTACTTCTTGCACTTTTACGG + Intergenic
992585481 5:78234810-78234832 TCCTAGATGTAGCACTCTAATGG - Intronic
993188824 5:84654760-84654782 CATTATATGTTGCACTGTTATGG - Intergenic
994523510 5:100873563-100873585 TGTTATATGGTGGACTCTGAGGG - Intronic
1003980339 6:11383347-11383369 TCATGTATGTTGCACTCTTGTGG + Intergenic
1008986543 6:57550744-57550766 TAATATATGTGGTACTCTTAGGG + Intronic
1010366355 6:75056255-75056277 TGCCATATGTTAAAATCTTATGG - Intergenic
1010824673 6:80457749-80457771 TCCTATTTGTGGCCCTCTTATGG + Intergenic
1012824744 6:104133128-104133150 TGTTTTATCTTGCACTTTTATGG - Intergenic
1017182589 6:151567726-151567748 TGCTATCTGTTGTACACTGAAGG - Intronic
1023062815 7:36344772-36344794 TGGTATATTTTGCATTCTTGAGG + Intronic
1028696010 7:93713465-93713487 TGCTTTAGCTGGCACTCTTATGG - Intronic
1031587516 7:123550517-123550539 TTCTATATGCTGCATTTTTAGGG + Exonic
1040412116 8:47164984-47165006 TTCTATATGCTGCATTTTTAGGG - Intergenic
1045737278 8:105311063-105311085 TGCTATATGTTGCTCTTTCGTGG - Intronic
1052217005 9:25978964-25978986 TGCCATAAGTTCCACGCTTATGG + Intergenic
1055535862 9:77243751-77243773 TGATAGATGTTATACTCTTATGG + Intronic
1056067493 9:82952196-82952218 TTCTAAATCCTGCACTCTTATGG + Intergenic
1058487222 9:105453823-105453845 TGCTAGATATTCTACTCTTAGGG + Intronic
1186210458 X:7245074-7245096 TGCTATATGTTGCACTCTTATGG + Intronic
1188103428 X:26118999-26119021 TGCCATATGTTGCTTTCTTGGGG + Intergenic
1193641744 X:84017348-84017370 TGCTATGTGTTCCACAATTATGG - Intergenic
1198445129 X:136705734-136705756 TGATAAATTTTGAACTCTTATGG - Intronic