ID: 1186211585

View in Genome Browser
Species Human (GRCh38)
Location X:7255888-7255910
Sequence CTCTGTGAGGGCACTGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186211582_1186211585 6 Left 1186211582 X:7255859-7255881 CCTTCAAGCTATGCATCATTGCA 0: 1
1: 1
2: 1
3: 4
4: 97
Right 1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG 0: 1
1: 0
2: 0
3: 20
4: 247
1186211580_1186211585 8 Left 1186211580 X:7255857-7255879 CCCCTTCAAGCTATGCATCATTG 0: 1
1: 1
2: 0
3: 14
4: 117
Right 1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG 0: 1
1: 0
2: 0
3: 20
4: 247
1186211579_1186211585 9 Left 1186211579 X:7255856-7255878 CCCCCTTCAAGCTATGCATCATT 0: 1
1: 1
2: 0
3: 10
4: 144
Right 1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG 0: 1
1: 0
2: 0
3: 20
4: 247
1186211581_1186211585 7 Left 1186211581 X:7255858-7255880 CCCTTCAAGCTATGCATCATTGC 0: 1
1: 1
2: 1
3: 5
4: 77
Right 1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG 0: 1
1: 0
2: 0
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186211585 Original CRISPR CTCTGTGAGGGCACTGATCT AGG Intronic
900244165 1:1629995-1630017 CTCTGGGTGGGCTGTGATCTGGG - Intronic
901158333 1:7155370-7155392 CTCTGTGAGGGCACCGTTGGGGG + Intronic
902629282 1:17695205-17695227 CTCTGGGTGGGCACTGACCAGGG + Exonic
902828677 1:18995546-18995568 CTTGGTGATTGCACTGATCTCGG - Intergenic
904009265 1:27380678-27380700 CTCTCTGAGGGCTCTGACATTGG - Intronic
904307088 1:29597037-29597059 CTCAGGGAGGGCAATGATCCAGG + Intergenic
904562397 1:31407375-31407397 CTCTGTGTGGGCACTCACATGGG + Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905312379 1:37058879-37058901 CTATTTGTGGGCACTGAACTAGG - Intergenic
906632538 1:47384252-47384274 CTATGTGCAGGCACTGGTCTAGG - Intergenic
907451772 1:54550063-54550085 CTCTGTGAGGGTCCTTATCTGGG - Intronic
907719351 1:56957136-56957158 CTCTCTGAGGGCAGGGACCTTGG + Intronic
908745517 1:67372640-67372662 CTCTGTGATGGCATTAATGTGGG - Exonic
912867713 1:113273116-113273138 CTTTGTGATGGAACTGTTCTGGG - Intergenic
916127366 1:161583080-161583102 CTATGTGCAGGCACTGTTCTAGG + Intronic
916137285 1:161664884-161664906 CTATGTGCAGGCACTGTTCTAGG + Intronic
916473879 1:165149771-165149793 CTCTATCACGGCACTCATCTTGG - Intergenic
917485617 1:175452243-175452265 CTGTGTGCAGGCACTGTTCTGGG + Intronic
917514143 1:175692972-175692994 CTCTGTGCAGGCACTGTTCCAGG + Intronic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
918193898 1:182203079-182203101 CACTGTGAGGGAACTGTTCGAGG - Intergenic
918720440 1:187845798-187845820 CTCCATGAGGGCACAGATCTTGG - Intergenic
919169261 1:193933149-193933171 CTCAGTGAGGGCATTGACCATGG + Intergenic
921104040 1:211958764-211958786 CTCTTTGAGGAAACTGATATTGG + Intronic
921268046 1:213442320-213442342 CTGAGTGTGGGCACTGTTCTGGG - Intergenic
922204092 1:223431491-223431513 CTATGTGCAGGCACTGAGCTGGG + Intergenic
922680944 1:227595357-227595379 CTGTGTAAGGGAACTGGTCTGGG + Intronic
1062982938 10:1740444-1740466 GGCTGTGCGGGCACTGACCTGGG + Intergenic
1063827978 10:9920328-9920350 CTGTGTGTGGGCACTGTACTGGG + Intergenic
1065761906 10:28990487-28990509 CTCAGTGAGGGGACTGAAGTTGG + Intergenic
1068519449 10:58062709-58062731 CTATGTGGGGGCCCTGACCTCGG + Intergenic
1069823177 10:71239921-71239943 TTCTGTGAGGGGACTGGCCTTGG + Intronic
1070108598 10:73460900-73460922 CTCTGTGAGGGCTCTGCCCCTGG - Intronic
1070325632 10:75387099-75387121 CTCTGTCTGGGCACTGTTCTTGG + Intergenic
1070394202 10:75997903-75997925 CTCTGAGAGAGCACTGAGTTGGG - Intronic
1074019758 10:109570292-109570314 CACTTTGAGGACACTGATATGGG + Intergenic
1074470742 10:113724369-113724391 CTATGTGCAGACACTGATCTAGG - Intronic
1075483110 10:122799043-122799065 CTCTGTGAGGGCACTGCCCCAGG - Intergenic
1076058549 10:127395248-127395270 ATCTGTGAGTGCCTTGATCTAGG - Intronic
1076569102 10:131420679-131420701 CTCTGAGTGGGCACTGTTCCTGG - Intergenic
1079029172 11:16973200-16973222 CCCTGTGAGAGAGCTGATCTGGG - Intronic
1079798683 11:24841325-24841347 ATCTGTGAGGACTCTGATCTTGG + Intronic
1081410913 11:42757215-42757237 GTCAGTGAGGGGAATGATCTAGG + Intergenic
1081598955 11:44478854-44478876 ATCTGTGAGGGCCTTGATCTTGG + Intergenic
1081700411 11:45148943-45148965 CTCTTCTAGGGCTCTGATCTTGG + Intronic
1084449586 11:69228118-69228140 CTCTCTGAGGGCAGGGATTTTGG + Intergenic
1085224484 11:74907272-74907294 CCCTGTGAGTGCAAAGATCTTGG + Exonic
1089252688 11:117176503-117176525 CTCTGACAAGGCACTGATCTGGG + Intronic
1090039614 11:123278965-123278987 CTCTGTGAAGGCAGGGATCAAGG - Intergenic
1090949199 11:131457899-131457921 TTCTGTGAGGGCTCTCTTCTGGG - Intronic
1091449075 12:561588-561610 CTCTGTGAGGGGACAGCTCCAGG - Exonic
1091617109 12:2057875-2057897 CTCTGTGACTGCACAGGTCTGGG - Intronic
1092929727 12:13304635-13304657 CTATGTGAATGCACTGAACTTGG - Intergenic
1094844493 12:34355471-34355493 CTCTCTGTGGGCACGAATCTGGG + Intergenic
1095709670 12:45275040-45275062 CTCTGTAAGGACATTGATCCTGG + Intronic
1095955917 12:47805859-47805881 CCCTGGGAAGTCACTGATCTAGG + Intronic
1096226739 12:49870885-49870907 CTCTGTGAGGACAGGGATCCCGG - Intronic
1098389403 12:69953162-69953184 CTCTCTGAGGGCACATATCAAGG + Intronic
1099996425 12:89784384-89784406 CTCACTCAGGGCCCTGATCTTGG - Intergenic
1100078860 12:90823990-90824012 CGCTGTGAGGGCCCTTCTCTGGG + Intergenic
1101018035 12:100522280-100522302 CTATGTGCAGGCACTGTTCTGGG + Intronic
1101136319 12:101747442-101747464 CTCTTTGTGGGCACATATCTAGG - Intronic
1101140613 12:101791953-101791975 CTCCGTGAAGGCACAGATTTGGG - Intronic
1101999544 12:109548360-109548382 ATCTGTGAGGGCTCTGCCCTAGG + Intergenic
1102090565 12:110183869-110183891 CTCTGTCAGGGCCCTGACTTTGG + Intronic
1102403622 12:112652794-112652816 CTCTTTGAGGGCAGAGGTCTTGG - Intronic
1103925357 12:124420842-124420864 TTCTGTGAGGCCTCTGAGCTGGG + Intronic
1104775496 12:131388070-131388092 CTCTGGGAGGGCAGGGGTCTCGG - Intergenic
1105237214 13:18568147-18568169 CGCTGTGAGGGCCCTTCTCTGGG - Intergenic
1106224631 13:27775646-27775668 CTCTGTGATGGCCCAGTTCTGGG + Intergenic
1106521509 13:30502259-30502281 CTACGTGTAGGCACTGATCTGGG + Intronic
1107009037 13:35649426-35649448 TTCTGTGAAGGCACTGATACAGG - Intronic
1110190221 13:72721654-72721676 CTCTCTGAAGGCAGTGAGCTGGG + Intronic
1110794322 13:79619505-79619527 CCCAGTCAGGGCTCTGATCTTGG + Intergenic
1112101839 13:96197968-96197990 CTCTGTGAGGGCCCTGTCCCTGG + Intronic
1114682910 14:24501954-24501976 CTTTGAGATGGCACTGCTCTTGG + Intronic
1117971200 14:61252505-61252527 CTCAGTGAGTGCTCTGACCTTGG - Intronic
1118295058 14:64560953-64560975 CTCTGAGAGGGCCCTCATTTAGG + Intronic
1118635595 14:67746195-67746217 CTCTGGGAGGGGACTGGGCTGGG + Intronic
1119067924 14:71549358-71549380 CTCTGTGAGGGCAAGCATCATGG - Intronic
1119197478 14:72727766-72727788 CTCTGTGCAGGCACTGTGCTGGG - Intronic
1120102369 14:80460345-80460367 CTCTCTGTGGACACAGATCTTGG + Intergenic
1121814572 14:96919455-96919477 CTGTGTGATGGCACTGTCCTGGG + Intronic
1123430610 15:20212436-20212458 CTATGTGCAGGCACTGATCTAGG - Intergenic
1124048994 15:26177558-26177580 CTCTTTGAGAGCTCTGATGTTGG - Intergenic
1124650013 15:31467583-31467605 CTCTGAGATGTCACCGATCTGGG + Intergenic
1126315088 15:47361580-47361602 CTCTGTGAGGGCAGGGACTTGGG + Intronic
1127988710 15:64095604-64095626 CTCTGTGAGGGCATTGTGCTTGG + Intronic
1129151085 15:73688176-73688198 CTCTGTCAGGCCACACATCTGGG - Intronic
1129811933 15:78518145-78518167 CTCTGTCAAGGCAGTGAGCTGGG + Intronic
1130244951 15:82238504-82238526 CCCTGTGAGCGCATTAATCTAGG + Exonic
1130325301 15:82874870-82874892 CTGTGTGAGGGCACAGTTATCGG - Intronic
1130455677 15:84104600-84104622 CCCTGTGAGCGCATTAATCTAGG - Intergenic
1130734966 15:86538479-86538501 CTCTTTGAGGGAAATGATATTGG - Intronic
1130793342 15:87180255-87180277 CTATGTGAAGGCACTGAACATGG + Intergenic
1130915070 15:88298654-88298676 CTCTGTGCCAGCACTGAGCTGGG - Intergenic
1131871824 15:96771719-96771741 CTCTGTGCCTGCACTGCTCTGGG + Intergenic
1132405975 15:101542113-101542135 GGCTGTGTGGGCACTGAGCTGGG - Intergenic
1136586022 16:31185290-31185312 ATCTGTGAGGGCTTTGATTTGGG + Intronic
1137633796 16:49967907-49967929 CTCTGTGAGAACACTGCTTTAGG - Intergenic
1139358841 16:66383921-66383943 CTCAGTGAGGGCACTGACAGGGG - Intronic
1141294713 16:82756903-82756925 CTCTGTGAGGGCCAGGATTTGGG + Intronic
1141421473 16:83920593-83920615 CTCCCTGAAGGCAGTGATCTTGG - Exonic
1203115608 16_KI270728v1_random:1487220-1487242 CTATGTGCAGGCACTGAGCTAGG + Intergenic
1143147552 17:4786404-4786426 CTCTGTGAGGGCTCCGATTGCGG + Exonic
1146765482 17:35517129-35517151 AGCAGTGAGGGCACAGATCTTGG + Intronic
1147431278 17:40372227-40372249 CTCTGGAAGGGCAGGGATCTCGG - Intergenic
1147810470 17:43166363-43166385 CTCTGTAAGGGAACTGGTCTGGG + Intergenic
1149639328 17:58192901-58192923 CCCTGTGAGGGCACTGACCCAGG + Exonic
1151806288 17:76407605-76407627 ATCAGTGACGGCACTGATTTAGG - Intronic
1152407258 17:80104809-80104831 CACTGTGTGGGCACTGCTCTGGG - Intergenic
1152814599 17:82399954-82399976 CACTGTGCGGGCGCTGAGCTAGG + Intronic
1154014271 18:10602945-10602967 CTATGTATGGGAACTGATCTGGG + Intergenic
1155397200 18:25398891-25398913 CTCTGTGAGGGCTCTTTTCTTGG - Intergenic
1155755706 18:29492950-29492972 ATGTGTGAGTGCATTGATCTTGG - Intergenic
1156763353 18:40620559-40620581 CTCTGGGTGGCCACTGACCTGGG - Intergenic
1157428125 18:47601509-47601531 CTTTGGGAGGGCACAGCTCTTGG + Intergenic
1157675960 18:49568926-49568948 CCCTGTCAGAGCACTCATCTGGG - Intronic
1158389684 18:57034944-57034966 CTCTGTCAGGGCTCTGACCCTGG - Exonic
1160005120 18:75063698-75063720 CTCTGTGCGGTCACTGAATTAGG + Exonic
1161881534 19:6957726-6957748 CTCTATGAGGGCAGGGATTTTGG + Intergenic
1162057938 19:8076121-8076143 TTCTGTGAGGGCTCTCTTCTTGG - Intronic
1162198228 19:9002168-9002190 CTGTGTGCAGGCACTGTTCTAGG - Intergenic
1163473928 19:17514039-17514061 CTCTGTGAGGGGAATCATATCGG + Intronic
1164164474 19:22656846-22656868 CTCTTTAAGGGCACTTATTTTGG + Intronic
1164543493 19:29140060-29140082 TGCTGTGAGGGCACTGGCCTGGG + Intergenic
1165387488 19:35519352-35519374 ATCTGTGAGGGCAATGATCATGG + Intergenic
1165662949 19:37598103-37598125 CACTATGAGGATACTGATCTAGG - Intronic
1165996942 19:39850243-39850265 CTCTGTGAGGGCCCTCTTCCTGG - Intergenic
1166094059 19:40528954-40528976 GACTGTGAGGGCACTGGGCTGGG - Intronic
925381464 2:3429930-3429952 CTCTGGGAGGGGACTGAATTGGG - Intronic
925395874 2:3533416-3533438 CTGTGTGAAGGCACTGACCACGG + Intronic
926567491 2:14492491-14492513 ATCTCTGAGGGCAGTGATTTTGG - Intergenic
931795245 2:65702146-65702168 CACTTTGAGGGCACTGCTCCAGG + Intergenic
933337311 2:80974963-80974985 CTCTGTGAGGAAAATGAGCTTGG - Intergenic
934032377 2:88059704-88059726 CTGTGTGAGGGACCTGATCAAGG - Intergenic
934034459 2:88077424-88077446 CCCTGTGAGGATAATGATCTCGG + Intronic
935213419 2:100957261-100957283 CTCTTGGAGGGCTCTGAGCTGGG + Intronic
935446175 2:103159018-103159040 CTCAGTGGGGGCCCTGAGCTTGG + Intergenic
937088157 2:119185905-119185927 CACTGGGTGGGCACTGAGCTGGG - Intergenic
937471102 2:122174629-122174651 CTCTGTGCTGGCACTGGGCTGGG - Intergenic
937862059 2:126719013-126719035 CTCTGTCAGCTCAGTGATCTGGG - Intergenic
937991500 2:127664650-127664672 CGCTGGGAGGGGACTGGTCTGGG + Intronic
938080149 2:128365616-128365638 CTCTGTCAGGTCACTCATCCTGG + Intergenic
938512563 2:131966366-131966388 CGCTGTGAGGGCCCTTCTCTGGG + Intergenic
940234862 2:151499519-151499541 CTCTGTTCAGGCACAGATCTGGG + Intronic
942777870 2:179606905-179606927 CTCTGGGAGGGCACACACCTTGG + Intronic
943293684 2:186109646-186109668 CTCTGTGACTCCACTGGTCTGGG - Intergenic
945320214 2:208412598-208412620 CTGTGTGAGGACACTGTACTGGG + Intronic
945603801 2:211901401-211901423 CTGTGTGTGGGCGCTGATCCTGG + Intronic
946123157 2:217534492-217534514 CTCTGAGAGGGCAAGGATTTGGG - Intronic
948562654 2:238864693-238864715 CTCTGTGGGGACACTGCCCTGGG + Intronic
1171096606 20:22338055-22338077 CTCTGTGATGACCCTGCTCTGGG - Intergenic
1172221089 20:33275690-33275712 CTCTGTGTGGACACAGAGCTGGG - Intronic
1172416165 20:34770012-34770034 CTCTGTTCTGTCACTGATCTAGG + Intronic
1174238738 20:49115763-49115785 CTGTGTGAGTGCACTGATGAAGG - Exonic
1174452438 20:50628614-50628636 TGCTGTGAGGGAACTGAACTGGG - Intronic
1174965813 20:55213580-55213602 CTTTGTGAGTGCACTGTGCTAGG + Intergenic
1175625820 20:60487455-60487477 CTCCGTGAGCGTACTGTTCTTGG + Intergenic
1176690611 21:9903883-9903905 CTCTATGAGGGCACTGAAGAGGG - Intergenic
1176781199 21:13196429-13196451 CGCTGTGAGGGCCCTTCTCTGGG - Intergenic
1181493834 22:23276898-23276920 CTCTCTGAGGGCAATGATGCAGG + Intronic
1182446421 22:30392411-30392433 CTCTGAGAGGTCACTGGTGTGGG + Intronic
1183476907 22:38040627-38040649 CTGTGTGCTGGCACTGAGCTAGG - Intronic
1184802073 22:46767526-46767548 CTCTGGGAGAGCAGAGATCTAGG - Intronic
952919965 3:38277376-38277398 TTCTCTGAGGGCACTGATTTGGG - Exonic
953948791 3:47171703-47171725 CTCTTGGACAGCACTGATCTAGG + Intergenic
955509904 3:59669212-59669234 CTATGTGAAGGCACTAAGCTAGG - Intergenic
955893065 3:63670742-63670764 CTATATAAGGGCACTGTTCTAGG - Intronic
956193056 3:66625381-66625403 CTCTGTGCTGGCACTGAGCTAGG - Intergenic
958167202 3:89891814-89891836 CTCTTTGAGGGCAGAGGTCTAGG - Intergenic
958613668 3:96461163-96461185 ATCCTCGAGGGCACTGATCTGGG + Intergenic
958720307 3:97835753-97835775 CTCTGTGAGGGCACAGTCTTGGG + Intronic
961465963 3:127081808-127081830 CTCTGTTTGGGCTCTGGTCTTGG + Intergenic
964643607 3:158935300-158935322 CTCTGTGAAGGCATGGATTTGGG - Intergenic
964933287 3:162051476-162051498 CTATGTACGGGCACTGGTCTGGG + Intergenic
967917639 3:194590616-194590638 CGCTGTGAGAACAATGATCTAGG - Intronic
969177253 4:5408041-5408063 ATCTGTCAGGGCCTTGATCTTGG + Intronic
969492245 4:7506050-7506072 CTCTATAGGGGCACTAATCTGGG + Intronic
970654117 4:18212714-18212736 ATCTGTGTGGGCCCAGATCTTGG + Intergenic
977487871 4:97671823-97671845 TTTTGTGAGGCCACTGGTCTAGG - Intronic
979371252 4:119889919-119889941 CTCAGTGATGGCACAGATCCTGG - Intergenic
981089813 4:140720988-140721010 CTGAGTGAGGGCTCTGACCTCGG - Intronic
982116008 4:152098950-152098972 CTCTCTGAGGAGACTGGTCTCGG - Intergenic
983114347 4:163794087-163794109 CTCTGTGAGGGAACTGCTTAAGG + Intronic
983897783 4:173100038-173100060 CTATGTATGGGAACTGATCTGGG - Intergenic
984815894 4:183835756-183835778 ATCTGTGAGGGGAAAGATCTGGG + Intergenic
986986615 5:13507516-13507538 CTCTGTGTGGCCTCTGTTCTAGG - Intergenic
987761984 5:22176785-22176807 CTCTATGAGGGCTCTGAGTTTGG - Intronic
990855707 5:60264663-60264685 CACTGAGATGGCACTGAACTGGG + Intronic
991047849 5:62241401-62241423 CTATGTGCAGGCACTGAGCTAGG - Intergenic
991138470 5:63211234-63211256 CTCTGTTAGGGCCCTGGTTTTGG + Intergenic
991896775 5:71410248-71410270 CTCTATGAGGGCTCTGAGTTTGG - Intergenic
992704795 5:79380251-79380273 CTGTGTGACAGCACTGCTCTTGG + Intronic
994719400 5:103363818-103363840 CTCTGTGAGGGCACAGGCTTGGG - Intergenic
995547834 5:113250502-113250524 CTCTGTGAAGGAACAGATGTTGG - Intronic
997649095 5:135502316-135502338 TACTGTGAGGGCAGTGATATAGG + Intergenic
997848615 5:137310976-137310998 CTCTGTGAGGGAACAGGCCTTGG + Intronic
998462779 5:142321841-142321863 CACTGTGGGGGCACAAATCTTGG + Intronic
998806361 5:145920961-145920983 ATCTGTCAGCCCACTGATCTTGG + Intergenic
1000535395 5:162472130-162472152 CTGTGTTAGGTCACTGCTCTGGG + Intergenic
1000680278 5:164175149-164175171 GTCTCTGTGGGCAGTGATCTGGG + Intergenic
1001494327 5:172177289-172177311 CTCTGTGGGAGCCTTGATCTTGG + Intronic
1001649185 5:173303230-173303252 GTAAGAGAGGGCACTGATCTAGG - Intergenic
1002554668 5:180026999-180027021 CTCAGTAAGGGCAATGATCCGGG + Intronic
1002664831 5:180815389-180815411 ATCTGTGAGGGGACTGAGTTGGG - Intronic
1004957389 6:20744469-20744491 CTCAGTGAGGACAGGGATCTGGG - Intronic
1006096293 6:31658863-31658885 GACAGTGAGGGCACTGCTCTTGG - Exonic
1006357795 6:33570961-33570983 GTCTGTGATGTCACTGAGCTGGG - Intergenic
1006584015 6:35093858-35093880 CTTTGTGAGGGCAGAGGTCTTGG - Intergenic
1008123255 6:47641617-47641639 CTATGTACGGGAACTGATCTGGG - Intergenic
1009694359 6:67081170-67081192 CTCTGTGCTGGCACTATTCTAGG - Intergenic
1009897622 6:69772863-69772885 CTCTGTTAGTGCAATGATATAGG - Intronic
1013941125 6:115664205-115664227 CTCTGAGAGGGCACTATTGTTGG + Intergenic
1014973117 6:127843669-127843691 ATCTGGGAGGGCACTGAACAAGG - Intronic
1016718300 6:147260652-147260674 CTCTATGTGGGCACTGAACGAGG + Exonic
1017891196 6:158640676-158640698 TGCTGTGAGAGCACTGAACTGGG - Intronic
1018549651 6:164981083-164981105 CTCTGTGAGGACACTCTTCCAGG + Intergenic
1018804669 6:167249469-167249491 CTCTCTGTGGGCAATGATCTGGG + Intergenic
1018825975 6:167408187-167408209 CTCTCTGTGGGCAATGATCTGGG + Intergenic
1018926919 6:168212910-168212932 CTGGGTGAGGGCCCGGATCTTGG + Intergenic
1019416936 7:932171-932193 CTTTGGGAGAGCACTGAGCTGGG - Intronic
1020275646 7:6622964-6622986 CGCTGTGAGGGCCGTGATCGGGG + Exonic
1021063350 7:16141896-16141918 GTGTGTGAGGACAATGATCTGGG - Intronic
1023502684 7:40866940-40866962 CTCTGTGTGGGCGCTTTTCTGGG + Intergenic
1032806684 7:135362015-135362037 CTCTGAGATAGCACTGCTCTGGG - Exonic
1032840629 7:135710962-135710984 CTCTGAGAGGGCGGTGATCATGG + Intronic
1033157181 7:138967123-138967145 CTCTGTGCAGGCACTGTGCTGGG - Intronic
1034542746 7:151769550-151769572 CTCTGGGAGGGCTCTGTTCCAGG - Intronic
1034754972 7:153607731-153607753 CTCTCTAAGGGGACAGATCTGGG - Intergenic
1034926952 7:155130110-155130132 CTCTGTGAGGGAAGTGCACTGGG - Intergenic
1035317974 7:158009019-158009041 CTCTGTGAGTGCAGTGACCTCGG - Intronic
1035938856 8:3873889-3873911 CTGGGGGAGGTCACTGATCTTGG + Intronic
1037352331 8:17974310-17974332 CTCTGTGAGGGCAAAGCACTAGG - Intronic
1037389474 8:18378884-18378906 CTCTATCAGGCCACTGATTTGGG + Intergenic
1039228042 8:35411502-35411524 CTATGTGTGAGCACTGTTCTGGG - Intronic
1040602279 8:48896898-48896920 CACTCTGAGGGCTCTGCTCTGGG + Intergenic
1041316922 8:56573608-56573630 CTCTCTGAGGGCAGGGATCATGG + Intergenic
1041381858 8:57259977-57259999 CGGTGTGAGGGCAGTGAACTTGG + Intergenic
1041595259 8:59643224-59643246 CTCTTTGTGTGGACTGATCTTGG + Intergenic
1043911090 8:85864939-85864961 CCCTGTGATTGCCCTGATCTAGG - Intergenic
1047761234 8:127956051-127956073 CTCTGAGAGGGCACTAACCCAGG - Intergenic
1048094925 8:131281697-131281719 CTCTGTGTGGACACTGATACTGG + Intergenic
1048365159 8:133732089-133732111 CTCTTTGAGGGCAGAGATTTAGG - Intergenic
1048423005 8:134295555-134295577 TTCTGTGTGGGCACTGCTGTGGG - Intergenic
1049159627 8:141089052-141089074 CCCAGGGAGGGCACTCATCTGGG - Intergenic
1049595272 8:143480524-143480546 GACTGCGAGGCCACTGATCTGGG - Intronic
1049679996 8:143913871-143913893 CTCTGTGGGGCCACTGATTTAGG - Intergenic
1051343730 9:16133935-16133957 CTCTTGGAGGGCTCTGAGCTCGG - Intergenic
1052507863 9:29378356-29378378 CTATGTACGGGAACTGATCTGGG - Intergenic
1052577768 9:30312064-30312086 CTCTGTGAAGGCTCTGCCCTTGG + Intergenic
1055019461 9:71653524-71653546 CTCTGTGAGGCCCCTGTTCCTGG + Intergenic
1056059946 9:82874438-82874460 CATTGTGAGGACCCTGATCTTGG - Intergenic
1056302030 9:85251762-85251784 CTCTGTGAGGGCTGGGACCTTGG - Intergenic
1057482054 9:95452497-95452519 CTTTGTGAGGGACCTGCTCTTGG - Intronic
1057883118 9:98808066-98808088 CGCTGTGAGTGCACAGCTCTGGG + Exonic
1060877648 9:127094815-127094837 CTTTGTGACTGCACTGAGCTTGG + Intronic
1061117824 9:128625815-128625837 ATCTTTGAGGGCAGTGATGTTGG - Exonic
1062337285 9:136077623-136077645 CTCTGTGAAGGGCCTGTTCTGGG - Intronic
1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG + Intronic
1186749697 X:12608796-12608818 CTCTATGAGGGCAAGGAACTTGG - Intronic
1189381632 X:40506541-40506563 CACTTTGAGGGAACTGATGTGGG - Intergenic
1190703589 X:53006483-53006505 CTCTGTGAGGGCTCTGCCCCAGG + Intergenic
1192709720 X:73567240-73567262 CTCTGCGTGGGCTCTTATCTGGG + Intronic
1197315416 X:124959930-124959952 ATCTGTGAGGCCACTGAATTAGG - Intronic
1197588953 X:128384471-128384493 CTCTGTGAGGGTTCTTAGCTTGG - Intergenic
1197892645 X:131281596-131281618 ATCTTTCTGGGCACTGATCTGGG + Intronic
1202126369 Y:21572387-21572409 CTATGTATGGGAACTGATCTGGG - Intergenic