ID: 1186213072

View in Genome Browser
Species Human (GRCh38)
Location X:7270606-7270628
Sequence CAGAGTATACATAAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186213071_1186213072 0 Left 1186213071 X:7270583-7270605 CCTAATCAACTCTACTCGATGCA 0: 2
1: 0
2: 1
3: 0
4: 49
Right 1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186213072 Original CRISPR CAGAGTATACATAAAGATGC TGG Intronic
902319241 1:15648747-15648769 CAGAGTAAACACCTAGATGCAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
907328920 1:53658857-53658879 CAGAGTAGGCACAAAGAAGCTGG + Intronic
910163335 1:84297911-84297933 CAGAGAAAAGCTAAAGATGCAGG - Intergenic
910296481 1:85651017-85651039 TAAATTTTACATAAAGATGCTGG - Intronic
912719712 1:112009833-112009855 CAGATTATACATAAAGCAACTGG + Intergenic
915077340 1:153320050-153320072 CATAGTGTAAATAAAGCTGCCGG - Intergenic
918253127 1:182722651-182722673 GAGAGGACACATAGAGATGCAGG - Intergenic
918394803 1:184102592-184102614 AAGAGTATAAACAAAGATGGAGG - Intergenic
918998477 1:191794604-191794626 CAGAAGATACATAAAGATAGTGG + Intergenic
920985605 1:210885755-210885777 CACAGTATAAAAAAAGCTGCAGG + Intronic
921699924 1:218257253-218257275 CACAGTACAAATAAAGAGGCTGG + Intergenic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
1067657313 10:48205474-48205496 CAAAATATTCATAAAAATGCAGG - Intronic
1068168602 10:53362908-53362930 CAAAATACACATAAAGTTGCAGG + Intergenic
1075653259 10:124143986-124144008 CTGAGGATCCATGAAGATGCTGG - Intergenic
1075690451 10:124390388-124390410 CAGACCATACAGAAAGCTGCCGG - Intergenic
1078809412 11:14743339-14743361 CACAGCATAAATAAAGCTGCTGG - Intronic
1079928762 11:26530914-26530936 AACAGGATACATAAAGATGGTGG - Intronic
1081276116 11:41150890-41150912 CAGAGAAAACATACAGATGATGG + Intronic
1082180885 11:49117886-49117908 TAGAGAAAACATAAAGATGTAGG + Intergenic
1086158205 11:83692011-83692033 CATTTTATAGATAAAGATGCTGG + Intronic
1086557361 11:88126793-88126815 CAGATTATACGTAAAGAAACAGG - Intronic
1087853786 11:103065754-103065776 AATAGTATACTTAAATATGCTGG - Intronic
1088134630 11:106539610-106539632 CAGAATATTCATGAAGAGGCAGG - Intergenic
1089085148 11:115810713-115810735 CACTTTATACATAAAGAGGCTGG - Intergenic
1092622026 12:10282689-10282711 TAGAGCATACATAATGATGTGGG + Intergenic
1093430645 12:19081329-19081351 CAGAGCATAAGTAAAGGTGCAGG + Intergenic
1093546217 12:20352237-20352259 CAGAGAAGACAGAAAGTTGCCGG + Intergenic
1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096681071 12:53255597-53255619 CAGACTACTCAGAAAGATGCAGG + Intergenic
1099126125 12:78760475-78760497 AAAAGTATACATGCAGATGCTGG - Intergenic
1100416848 12:94386875-94386897 AAAAGTATATATAAAGATACTGG + Intronic
1100551478 12:95650176-95650198 CAGGGTGTACACCAAGATGCTGG - Intergenic
1100718912 12:97335631-97335653 CTGAGTATATATAAAGATTTGGG - Intergenic
1105427897 13:20311399-20311421 CAGAGTTTTCCCAAAGATGCAGG - Intergenic
1106675520 13:31954093-31954115 CAGATTATAAAAAAAGATGGAGG - Intergenic
1106935541 13:34714644-34714666 CAGCATACACATAGAGATGCAGG + Intergenic
1108726009 13:53182261-53182283 CAGATTACACATGAAGAAGCAGG - Intergenic
1109833433 13:67824372-67824394 CAGTGTCTCCATATAGATGCTGG + Intergenic
1110383385 13:74879736-74879758 CAGAATATGGATCAAGATGCAGG - Intergenic
1113271284 13:108677398-108677420 CAGTGTATACATATATATTCAGG + Intronic
1115420277 14:33186036-33186058 CAGAATATAATTCAAGATGCTGG + Intronic
1115710558 14:36046268-36046290 CAGAGGAAACGTAAAAATGCAGG + Intergenic
1115895967 14:38087683-38087705 CAAAATATACACAAAGATTCAGG + Intergenic
1117322927 14:54641298-54641320 CAGAGTATGCCTAGAGATGTTGG - Intronic
1117624240 14:57618902-57618924 CACAGTGTAAACAAAGATGCTGG + Intronic
1118702645 14:68449379-68449401 CAAAGTCTCCTTAAAGATGCTGG + Intronic
1119365857 14:74090956-74090978 AAGAGTATGAATGAAGATGCAGG + Intronic
1120695942 14:87645223-87645245 CAGAGTATACCTATGGATGGTGG - Intergenic
1125358804 15:38844495-38844517 CAGAGTATACACACAGACACAGG + Intergenic
1126862731 15:52902757-52902779 CACAGTGTAAATAAAGCTGCCGG + Intergenic
1128244558 15:66124266-66124288 CAGAGAATGAATAAAGAAGCGGG + Intronic
1128272286 15:66321086-66321108 CAGAGGCTGCATAAAGCTGCAGG + Intronic
1131433288 15:92403386-92403408 GAGAGTTTGCACAAAGATGCTGG + Intronic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1134528434 16:14963032-14963054 AAGAGTATACAGGCAGATGCAGG + Intergenic
1135894957 16:26391721-26391743 CAGAGTATTTGTAAAGATGCTGG + Intergenic
1148703400 17:49606032-49606054 GAGGATATACATAAAGATACAGG - Intronic
1150280323 17:63926280-63926302 CAGAGTGTAAATGAAGATGGAGG + Intergenic
1151692017 17:75692405-75692427 CAGAGTTCACAGAAAGTTGCTGG - Intronic
1158194747 18:54872178-54872200 CAGAGAACACATAAAGCTGTCGG - Intronic
1164152362 19:22566100-22566122 CACAGTATAAACAAAGCTGCAGG - Intergenic
1164451313 19:28367769-28367791 CAGAATATATACAAAGATGAAGG - Intergenic
1166014246 19:39968271-39968293 AAGAGTATACATACAAATGGTGG + Intergenic
1167247080 19:48380034-48380056 CAGACTATTCAAAGAGATGCCGG + Intergenic
1167655901 19:50764000-50764022 CAGGGTATACAAAAAGGAGCTGG + Intergenic
1202638232 1_KI270706v1_random:60177-60199 CAGAGTATTCATATAGATTTTGG - Intergenic
925139614 2:1540809-1540831 CGGAGTAAACAGAAATATGCAGG - Intronic
927280682 2:21303197-21303219 CAGAGTTTACTTAAGGATTCTGG - Intergenic
927403065 2:22736127-22736149 GAAAATATATATAAAGATGCAGG - Intergenic
927405916 2:22766729-22766751 CAGAGTTTATATACAGATGTGGG - Intergenic
929679645 2:43979297-43979319 CAGAGTATAAATAAAAATTAAGG - Intronic
932199436 2:69812597-69812619 GAGAGTATACATGAAGATCTGGG - Intronic
935677464 2:105608385-105608407 CAGAGTATTAATAAAGTTGGTGG - Intergenic
936866781 2:117084015-117084037 CAGAGATCACATAAAGATTCAGG + Intergenic
939637187 2:144596336-144596358 CAGAATGTACATGCAGATGCAGG - Intergenic
939764399 2:146228105-146228127 CAGAGAAGACATAATGATACAGG + Intergenic
940133276 2:150408035-150408057 CAGGGTCTTCATAAAGATGAAGG + Intergenic
940188015 2:151008111-151008133 CAGAGAATACATGACGAAGCAGG - Intronic
943236447 2:185326989-185327011 CAGAGCATAGTTTAAGATGCTGG + Intergenic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1169374503 20:5055642-5055664 GAGAGCATACATGAAGATGTAGG + Intergenic
1172236004 20:33375103-33375125 CCAAGAATACATAAAGAGGCTGG + Intronic
1173096503 20:40034805-40034827 CAGAGTTTACATATAGATTTTGG - Intergenic
1173322453 20:42000633-42000655 CACAGAAAACATAAAAATGCAGG - Intergenic
1174294626 20:49536879-49536901 CAGAGAAAACACACAGATGCTGG + Intronic
1175875284 20:62226639-62226661 CAGAAAATAAATAAAGAGGCAGG + Intergenic
1176950153 21:15035071-15035093 AAGAGTATATGTGAAGATGCAGG + Intronic
1179483471 21:41693595-41693617 CTGAGTATACAAACAGATGTGGG - Intergenic
1184487440 22:44789004-44789026 CAGAATATGCATAAGGATGTAGG - Intronic
949846105 3:8372266-8372288 CACAGTGTAAATAAAGCTGCAGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
951304258 3:21039097-21039119 CAGATTTTACATAAAGTTCCAGG + Intergenic
951958408 3:28285175-28285197 CAGAGAATACACACACATGCTGG - Intronic
952032601 3:29162335-29162357 CAGATAATAAATAAAGAAGCAGG + Intergenic
952429451 3:33207777-33207799 CAGAGTCTTCTTAAAGGTGCTGG - Intronic
956326216 3:68055783-68055805 CAGAGCATAGATAAAGAAGATGG - Intronic
956384360 3:68701195-68701217 CAGAGCATACATGAAGAACCTGG - Intergenic
956572979 3:70717679-70717701 CAGAGTTTTCATAACGCTGCGGG + Intergenic
957809461 3:85200708-85200730 CAGAGTACAAATAAAAATGTTGG + Intronic
959719066 3:109467218-109467240 CACAGTAAACATAAAAGTGCAGG - Intergenic
962903095 3:139777614-139777636 CATAGTATTCATCAGGATGCTGG - Intergenic
963311768 3:143717460-143717482 CAGATTACACATAAAAATTCAGG + Intronic
968219724 3:196927662-196927684 CAGAATATGCATTAAGAAGCTGG - Intronic
968315275 3:197718771-197718793 CACAATATACAAAAAGATGAAGG + Intronic
970685260 4:18559779-18559801 CAGAGTGTAAACAAAGCTGCTGG + Intergenic
971379887 4:26087009-26087031 CAGAAAATACAAAAAGATGCAGG + Intergenic
972015829 4:34244122-34244144 CAGAGTATATGTAAAGACACTGG - Intergenic
972729414 4:41778847-41778869 CAAAATATACAGAAATATGCTGG + Intergenic
973875363 4:55212844-55212866 CTGTGTAAACATGAAGATGCAGG + Intergenic
974376487 4:61084094-61084116 TAGATTACAAATAAAGATGCAGG + Intergenic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
976242882 4:82976752-82976774 CAATGTATACATAAAGATGATGG + Intronic
976440010 4:85062202-85062224 ATGAATATACATAAAGATCCAGG - Intergenic
976534313 4:86193531-86193553 CACAGTGTAAACAAAGATGCTGG - Intronic
977356398 4:95952500-95952522 CAGAGGATATATGAAAATGCCGG - Intergenic
981787973 4:148502678-148502700 CACAGTGTAAACAAAGATGCCGG - Intergenic
984966445 4:185143935-185143957 CAGAGGTTACATAAAGATGAAGG - Intronic
985772193 5:1819210-1819232 CAAAGTCTACATTAAGATGCAGG - Intergenic
988607222 5:32689222-32689244 CAGAGAGTAGGTAAAGATGCAGG - Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
994664590 5:102692479-102692501 CTGAGTAGACATATAGATGAAGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
996075332 5:119186158-119186180 CAGAGTATACACGAAGCTTCAGG - Intronic
996463275 5:123771378-123771400 AAGAGTATACATATAGATAGAGG - Intergenic
1000125994 5:158244784-158244806 CTGATTATACACAAGGATGCAGG + Intergenic
1003931566 6:10928885-10928907 AAGAGTATACACAAACATGGAGG - Intronic
1006198366 6:32263069-32263091 CACAGTATAAACAAAGCTGCTGG - Intergenic
1010527271 6:76917414-76917436 CATAGTAGATATAAAGATGAAGG + Intergenic
1011570971 6:88734583-88734605 CATTTTAGACATAAAGATGCAGG + Intronic
1011828842 6:91344514-91344536 CAGAGTAAACCTAAAGAAACAGG + Intergenic
1011988241 6:93477659-93477681 AAGAGTAAAAATAAAGATGCAGG + Intergenic
1012878452 6:104757037-104757059 CACAGTATAAACAAAGAGGCAGG + Intronic
1015917792 6:138235323-138235345 CAGGGAACACACAAAGATGCAGG - Intronic
1016372271 6:143387509-143387531 CTGATTATACATAAAAATGCTGG - Intergenic
1017261171 6:152389549-152389571 CAGAGTATCCATAAATAATCTGG - Intronic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1020391396 7:7662088-7662110 CACAGTGTAAACAAAGATGCCGG - Intronic
1022344812 7:29504037-29504059 CTGATTATACAAACAGATGCAGG - Intronic
1025748729 7:64271777-64271799 CAGAGGATGGATAAAAATGCCGG + Intergenic
1026193709 7:68153189-68153211 CAGAGGATACATAAACAAACTGG + Intergenic
1026219818 7:68384910-68384932 GAGAGTAGAGATAAAGATCCAGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1035676173 8:1457434-1457456 CCGAGTATAGATAAATATGCTGG - Intergenic
1036191831 8:6678014-6678036 CAGAGTATACAGGAAGGAGCGGG + Intergenic
1039159570 8:34602329-34602351 CATGGTATACATAAGTATGCTGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040946493 8:52890459-52890481 AAGAGAATACATGAAGGTGCAGG - Intergenic
1041388817 8:57331136-57331158 CAGGGGCTACAAAAAGATGCAGG - Intergenic
1043027653 8:75091084-75091106 AATAGTATATAAAAAGATGCAGG + Intergenic
1044448264 8:92303058-92303080 AAGAGAATGCATAAAGGTGCAGG - Intergenic
1045153197 8:99433528-99433550 CAAAGTATTCATAAAAATGTTGG + Intronic
1047414077 8:124649553-124649575 CAGAGTACACAAAAAGCTCCCGG + Intronic
1047864914 8:129012474-129012496 CAGAGCATACGTAAAGGAGCAGG - Intergenic
1050299326 9:4241128-4241150 CAGAGTGTGCACAAAGAAGCAGG - Intronic
1050816847 9:9824248-9824270 CTAAGGATAAATAAAGATGCAGG - Intronic
1052709472 9:32035769-32035791 CAGAGTATGAATAGAGAAGCAGG + Intergenic
1055505463 9:76943812-76943834 CAGAGTATATGTACGGATGCTGG - Intergenic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186610304 X:11132234-11132256 CAGAGTATTCAAATAGGTGCTGG + Intergenic
1189052779 X:37663946-37663968 CACAGTTTACATCAAGAAGCTGG + Intronic
1190468971 X:50756819-50756841 CAGATTATACATTAAAAAGCAGG - Intronic
1191088703 X:56597444-56597466 CACAGTATAAACAAAGCTGCCGG - Intergenic
1194922253 X:99780552-99780574 CAGATGATATATAAAAATGCCGG - Intergenic
1196664658 X:118303919-118303941 CAGAGAAGACATGTAGATGCAGG + Intergenic
1199215847 X:145259653-145259675 GGGAGTATACATAAAGAGGGTGG + Intergenic