ID: 1186219531

View in Genome Browser
Species Human (GRCh38)
Location X:7334620-7334642
Sequence GTGGCTTGCTAGAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186219531_1186219534 -7 Left 1186219531 X:7334620-7334642 CCCTCACTCTTCTAGCAAGCCAC 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1186219534 X:7334636-7334658 AAGCCACTAAAGGCTAGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186219531 Original CRISPR GTGGCTTGCTAGAAGAGTGA GGG (reversed) Intronic
900954681 1:5879172-5879194 GTGGCTTGTTAGAGGTGGGAGGG - Intronic
906035401 1:42747554-42747576 GTGACTGGTTAGAGGAGTGATGG + Intronic
906680840 1:47724737-47724759 GTGACTTGCAAGAAGAGATAGGG + Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907997425 1:59647073-59647095 GTGGCATGATAAAAGACTGAGGG + Intronic
908604994 1:65788503-65788525 GTTGCTTTCAAGAAGACTGAGGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
910087565 1:83421052-83421074 GTGGCTTCCTCAAAGAATGATGG - Intergenic
910453509 1:87371655-87371677 GTGGTTCAGTAGAAGAGTGAAGG + Intergenic
911012807 1:93299571-93299593 GTTGCTTGCTTGAAGATGGAGGG - Intergenic
911121817 1:94303869-94303891 GTAGCTGGCAAGAAGAGTGCTGG - Intergenic
911374354 1:97032927-97032949 GTGGTTTGGTATAAGAGTGAAGG + Intergenic
914449210 1:147775757-147775779 ATGGCTTGCTAGAAAAGTCCAGG + Intergenic
915709591 1:157882808-157882830 GTGGCTTCCCAGAAGAAGGAAGG - Intronic
916892098 1:169121978-169122000 GTGGATGGCTAGACAAGTGAAGG - Intronic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
917801934 1:178579579-178579601 CTGGCTTGATTGAAGAGTGGAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922814703 1:228440127-228440149 GGGGCTTGCAGGAAGGGTGAGGG + Intergenic
1065320351 10:24503240-24503262 GACGGTTGCTAGAAGAGTGAGGG + Intronic
1065735235 10:28745433-28745455 GTTGACTGGTAGAAGAGTGAAGG + Intergenic
1071025367 10:81106906-81106928 GTGGACTGCTAGAAGGGGGAGGG + Intergenic
1074627963 10:115214635-115214657 GTGGCTGGTTAGAGGAATGATGG + Intronic
1076721013 10:132393219-132393241 GTGGCCTGCTAGAAGGTCGAGGG + Intergenic
1078250196 11:9610413-9610435 GAGGCTCACTAGAAAAGTGATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078618296 11:12884793-12884815 GTGGCTAACAGGAAGAGTGATGG + Intronic
1080232990 11:30038850-30038872 GTGGCTTGCTCTAAGAGTTTAGG - Intergenic
1081818831 11:45970993-45971015 TTGGTATGCTAGAAGAATGATGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082921643 11:58501413-58501435 GAGGCTTGGGAGAAGAGGGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084612178 11:70210217-70210239 GTGGCTTCTAAGAAGAGTCAGGG - Intergenic
1084859933 11:72011654-72011676 GTGGCTGGGTAGGAGAGTGATGG + Intronic
1085346607 11:75772129-75772151 GTGGTTTGCTGAATGAGTGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086811326 11:91314061-91314083 GTGTCTTGCTATTAGACTGAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088261257 11:107945960-107945982 GTGTATTGCTTGAAGGGTGAAGG - Intronic
1088606115 11:111534551-111534573 GTGGGTTTCTAGAAGATTTAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091097118 11:132834516-132834538 GTCGCATGCTAGAAGAGGCAAGG - Intronic
1094278945 12:28712895-28712917 CTGGCTTGATAGAAGACAGATGG + Intergenic
1096271269 12:50167643-50167665 GTAGCTGGATGGAAGAGTGAGGG - Intergenic
1096622449 12:52873059-52873081 GTGGCGTGTTGGAAGAATGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098291838 12:68963943-68963965 GGGCCTTCCTAGAAAAGTGAAGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1099294457 12:80812854-80812876 TTGACTTGTTAGAAGAATGAAGG - Intronic
1100059646 12:90558626-90558648 GGGGACTGCTAGAGGAGTGATGG - Intergenic
1100790490 12:98124919-98124941 GTGGCTAGCTTGAAGATGGAGGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102640235 12:114360668-114360690 GTGGATAGATAGATGAGTGATGG + Intronic
1105835568 13:24208208-24208230 GTGGCCTCCCAGAATAGTGACGG + Intronic
1107714896 13:43190348-43190370 GTTGCTTGCTTGAAGATGGATGG - Intergenic
1110896834 13:80763298-80763320 GTGGCTTATTAGAAGAGTATTGG + Intergenic
1115742958 14:36407462-36407484 GTGGCTTCCTACCAGAGTGATGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116858052 14:49971124-49971146 GTGTCTTTGGAGAAGAGTGATGG + Intergenic
1121238499 14:92411182-92411204 GCGGCTTGCTGGCAGAGTGAAGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1123168951 14:106352927-106352949 GTGGCTTGATAGAGCAGGGAAGG - Intergenic
1125385649 15:39133759-39133781 GTGGCCTGCTATCAGTGTGAGGG - Intergenic
1126953318 15:53906865-53906887 GTGGCAGGAGAGAAGAGTGAAGG + Intergenic
1129544256 15:76377813-76377835 GTGGCTTTGAAGAAGGGTGAAGG + Intronic
1129932764 15:79426060-79426082 CTGGCGTGCTTGGAGAGTGAAGG + Intronic
1134215344 16:12312914-12312936 GTGGCTTGCCAGAGGTGGGATGG + Intronic
1139016788 16:62699020-62699042 GAGGCTTGAAAGAAGAGTGAGGG + Intergenic
1142605202 17:1077663-1077685 GTGGCTTGCCGGAAGAGAGATGG - Intronic
1143149791 17:4800784-4800806 CTGACTTGCTAGTAGAGGGAGGG - Intergenic
1145240017 17:21235716-21235738 GTGAATGGCTAGAACAGTGAGGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1149777247 17:59367670-59367692 GTGGCTTGTATGAAGAGTGTAGG + Intronic
1151165499 17:72199647-72199669 GTGGCTTGTTATAAGACTTATGG - Intergenic
1152536325 17:80952167-80952189 GTGACTTTCAAGAAGAGTGGTGG - Intronic
1154311472 18:13270060-13270082 GGGGCTTGCTAGAAATGTGGAGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1156982469 18:43306563-43306585 GTGGCTGTCTGGAAAAGTGATGG + Intergenic
1157304888 18:46509661-46509683 GTGGCTGGAAGGAAGAGTGAGGG + Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1163617372 19:18337459-18337481 GTGCGTTGCTAGAAGAGGGAAGG - Intergenic
1166322097 19:42024838-42024860 ATGGCTTCCCAGAGGAGTGAAGG - Intronic
1166656040 19:44612809-44612831 GTGGCTTGCTAGCAAAGAGGTGG + Intergenic
1167494320 19:49808926-49808948 GGGGCCTGCAAGAAGAGTGGAGG + Intronic
927596415 2:24401846-24401868 GGGGCCTGCTAGAAGGGTGGAGG - Intergenic
931173395 2:59828927-59828949 GCGGCTTGCCAGTAGATTGACGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933280913 2:80331741-80331763 TTGGCTTGAGAAAAGAGTGAGGG + Intronic
933385490 2:81605738-81605760 GTGTCTAGGTAGAAGAGTCATGG - Intergenic
933870078 2:86557551-86557573 GTGGAATGCAAGAGGAGTGATGG - Intronic
935352086 2:102159775-102159797 CAGGCTTGCAAGAAGAGAGAGGG - Intronic
935811743 2:106805022-106805044 ATAGCTTGCTATAATAGTGAAGG - Exonic
937088900 2:119191933-119191955 CTGGCTTGCTAGAAGATAGCTGG - Intergenic
937305605 2:120868696-120868718 GTGACTTGCTAGAAGAGAAATGG + Intronic
939745542 2:145961618-145961640 CTGGCTTGGGAGAAGGGTGATGG + Intergenic
942595910 2:177591715-177591737 GTGGGTTCCAAGAAGAATGATGG + Intergenic
944143561 2:196482455-196482477 GTTGCTTGCTGAAAGAATGATGG + Intronic
946170343 2:217891663-217891685 GGGGTTTGCTCTAAGAGTGATGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170732481 20:18986983-18987005 GAGGCTTGGCAGAAGAGTGATGG - Intergenic
1175805459 20:61826068-61826090 ATGGCTTGCAGGAAGAGTCAAGG - Intronic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1179964055 21:44790611-44790633 GTGGCAAGAAAGAAGAGTGAAGG - Intronic
1182518705 22:30873207-30873229 GTGGCCTGCAAGAGAAGTGATGG + Intronic
1182923780 22:34103866-34103888 ATGGCTTGCTAAAAGATGGAGGG - Intergenic
1183001280 22:34861466-34861488 GTGGCCTGAGAGCAGAGTGAAGG - Intergenic
1184689127 22:46109535-46109557 GGAGCTTGCTGGAAGAGTGGCGG - Intronic
950440584 3:13007998-13008020 CTGGCTTCCTAGAGGAGTGCAGG - Intronic
950982935 3:17328454-17328476 GTGGCCTGCTAGATGATTCAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952937824 3:38413830-38413852 GTGGACTGCAAGAAGAGAGAGGG - Exonic
954134361 3:48575307-48575329 GGGGCTGGCCAGGAGAGTGAGGG - Intronic
954208222 3:49076381-49076403 GTGACTTGCGTGATGAGTGAGGG - Intronic
957710027 3:83844313-83844335 GTTTCTTGGTAGAATAGTGATGG + Intergenic
959350001 3:105250072-105250094 GTGGGTTGCTAAGAGAGTGGGGG + Intergenic
961720965 3:128895755-128895777 GTGGCTTGCATAAAGAGTGGGGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967553318 3:190825388-190825410 GTGGGTTACTAGAAGAGTCTGGG + Intergenic
968065152 3:195754350-195754372 GTGGCTGGCTGCAAGTGTGACGG - Exonic
968220195 3:196931914-196931936 GTGGCTGGAGAGAAGAGGGAAGG + Exonic
968266489 3:197367291-197367313 GTGGCATTCTGGAAGACTGAGGG - Intergenic
969049166 4:4360485-4360507 GTTGATTGCTCGAAGAGTGGGGG - Intronic
969570024 4:8002776-8002798 GTGGGTTGGAAGAACAGTGAGGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
976058088 4:81092904-81092926 GTTCCTTGCTAGTAGAGTGAAGG - Intronic
978402617 4:108346913-108346935 GTACCTTGCTGGAACAGTGATGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979724973 4:123950118-123950140 GTAGGTTGTTAGCAGAGTGAAGG + Intergenic
980155181 4:129095979-129096001 GTGGTTTCCTAGAAGAAGGAAGG - Intronic
986048789 5:4067365-4067387 TTGGCTTGCTAGAGGCTTGAAGG + Intergenic
986879481 5:12153136-12153158 GTAGCTGGCTGGAAGAGTCAGGG + Intergenic
988469372 5:31524158-31524180 GTGGCCTGGTAGAAGATAGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG + Intronic
998076286 5:139239407-139239429 GTGGATTGGTCGAAGAGTGCAGG - Intronic
1000757990 5:165184559-165184581 GAGGGTGGCCAGAAGAGTGAGGG - Intergenic
1001683652 5:173576818-173576840 GCGGCAGGCCAGAAGAGTGAGGG + Intergenic
1005487533 6:26315210-26315232 GTGCATTGATATAAGAGTGATGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1005670032 6:28096428-28096450 GTGTTTAGCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1009595540 6:65730525-65730547 ATCCCTTGCTAGATGAGTGATGG + Intergenic
1010516780 6:76782823-76782845 GTGTCTTGGTAGAAGCATGATGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011129062 6:84035401-84035423 GTAGATTGCTAGAAAAGGGAAGG - Intronic
1012976167 6:105783401-105783423 ATGGAGTGCTAGAAGAGTGCTGG - Intergenic
1015120080 6:129691908-129691930 GTGGCTTGCAAGAACAGCCAAGG - Intronic
1016087169 6:139928047-139928069 CTGGCTTGCTAGAAGGGAAAAGG + Intergenic
1017474204 6:154771724-154771746 GGGGTCTGCTAGAAGAGGGAGGG + Intronic
1018340823 6:162849167-162849189 TTGGCGTGCAAAAAGAGTGAAGG + Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021925662 7:25531384-25531406 GTGGGCTGCTAGAGGAATGAAGG - Intergenic
1024634703 7:51277272-51277294 GTGCCTTGCTCTAAGAGAGAAGG + Intronic
1025784947 7:64635709-64635731 GTGTCTTCTTAGTAGAGTGATGG - Intergenic
1027304445 7:76877533-76877555 GTGGCTTCCTCAAAGAATGATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028277883 7:88880177-88880199 GTGTTTTGCTAGCAGAGTCAAGG + Intronic
1028294118 7:89105975-89105997 GTGGTCTGCAAGAAGAGTCATGG + Intronic
1028464114 7:91130210-91130232 GTGGCTGGATAGAAGAGAGTTGG - Intronic
1028759171 7:94475865-94475887 CTTGCTTACTAGTAGAGTGACGG - Intergenic
1028759378 7:94478373-94478395 CTTGCTTACTAGTAGAGTGATGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030740201 7:113100481-113100503 TTGGCTGGCTAGGAGATTGATGG + Intergenic
1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG + Intronic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1037297226 8:17413639-17413661 GTGGCCTCCTGGAAGAGAGATGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042720944 8:71826445-71826467 TTGGCTTGAGTGAAGAGTGAAGG + Intergenic
1044489582 8:92797051-92797073 ATGGCTGGCTTGAAGACTGAGGG - Intergenic
1046185268 8:110706190-110706212 GTGGCTTTGGAGAAGAGAGATGG + Intergenic
1048985417 8:139732296-139732318 GTGGCAGCCTTGAAGAGTGAAGG - Intronic
1050587251 9:7125349-7125371 GTGGCGTGAGAGAAGACTGATGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051498439 9:17750965-17750987 CAGGCTTCCTAGAAGAGAGAGGG + Intronic
1055953975 9:81756813-81756835 GGGCCTTGCTGGTAGAGTGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1059861027 9:118461981-118462003 GAGTATTGCTATAAGAGTGATGG - Intergenic
1060299792 9:122368577-122368599 GGGGCTTCCTAGAGGAGAGAAGG + Intergenic
1061481270 9:130898782-130898804 GTGGGTGGGTAGAAGAGGGAGGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187254035 X:17625210-17625232 GTGGCTTAATAGAAGACTGCTGG + Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195614967 X:106904766-106904788 TTGGCATGGTAGAAGAATGAGGG + Intronic
1196254864 X:113505321-113505343 GTGGCCTAGTAGAAGAGGGAGGG - Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic