ID: 1186219684

View in Genome Browser
Species Human (GRCh38)
Location X:7336244-7336266
Sequence CCCCACCCGCCCCAAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186219675_1186219684 -9 Left 1186219675 X:7336230-7336252 CCTAGGACTGCCCCCCCCACCCG 0: 1
1: 0
2: 0
3: 27
4: 418
Right 1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 231
1186219671_1186219684 30 Left 1186219671 X:7336191-7336213 CCCTTTTCTCTAAGGGGCTTTGG 0: 2
1: 0
2: 1
3: 26
4: 250
Right 1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 231
1186219673_1186219684 29 Left 1186219673 X:7336192-7336214 CCTTTTCTCTAAGGGGCTTTGGA 0: 2
1: 0
2: 3
3: 43
4: 278
Right 1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186219684 Original CRISPR CCCCACCCGCCCCAAAGGAG GGG Intronic
900172121 1:1274188-1274210 CCCCACCCGGCCCTTAGGGGAGG + Intergenic
900362866 1:2298399-2298421 CCACACCTGCTCCAAGGGAGAGG - Intronic
902184006 1:14711519-14711541 TCCCACCCCACCCAAAGGAAGGG - Intronic
902444933 1:16456522-16456544 CCCCACCTTCCCCAAAATAGTGG + Intronic
903177666 1:21590385-21590407 CCCACCACGCCCCCAAGGAGGGG + Intergenic
904468886 1:30723689-30723711 CCCCAGCCCCCCCAAAGGGCGGG + Intergenic
904775000 1:32901164-32901186 CCCCAACCCTCCCACAGGAGCGG - Intronic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905466145 1:38155174-38155196 CCTCACCAGCCCCACAGGTGGGG - Intergenic
906112009 1:43330380-43330402 CCCCTCCCGCCCCCAGGGAAGGG + Intergenic
906381184 1:45333023-45333045 CTACACCCACCCCAAAGTAGAGG + Intronic
906728364 1:48060384-48060406 CTACACCCTCCCCAAAGCAGTGG - Intergenic
906875002 1:49527900-49527922 CCACACCTGATCCAAAGGAGTGG + Intronic
910277387 1:85464361-85464383 CTCCACCCGCCCTACCGGAGCGG + Intronic
910472351 1:87568364-87568386 CACCACATGCCGCAAAGGAGAGG - Intergenic
912409145 1:109467453-109467475 CCCCTCCCGTCACCAAGGAGTGG - Intronic
915075165 1:153302300-153302322 AACCACCCAGCCCAAAGGAGAGG + Intronic
915185235 1:154099317-154099339 CCCCACCAGCTCAGAAGGAGTGG + Intronic
916713901 1:167434466-167434488 ACCCTCCCTCCCCACAGGAGGGG + Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
922744663 1:228037323-228037345 CCCCTCCAGCCCCAAAGGGTGGG + Intronic
922964150 1:229674069-229674091 CCCCACCTGTCTCAGAGGAGAGG - Intergenic
923094964 1:230767796-230767818 CCCCAGCCACACCCAAGGAGGGG + Intronic
923326765 1:232886906-232886928 CCCCACCAGCCACACAGGATAGG - Intergenic
923474610 1:234321040-234321062 CCCCCCCCACCCCAAAGGAATGG + Intronic
923555653 1:234998623-234998645 CCCCGCCCGCCCTAAAGGAGTGG + Intergenic
1063393533 10:5666072-5666094 CCTCACCCGCGCCAGTGGAGGGG + Intronic
1066066551 10:31765292-31765314 CCCCACCCTGCACAAAGGTGGGG + Intergenic
1067059357 10:43070000-43070022 CCCCAGGCACCCCCAAGGAGAGG + Intergenic
1067465163 10:46492167-46492189 CCCCACCCTACCCAAAGAAGAGG + Intergenic
1067540174 10:47145126-47145148 CCACTCCAGCCCCAGAGGAGGGG - Intergenic
1067622024 10:47892434-47892456 CCCCACCCTACCCAAAGAAGAGG - Intergenic
1068548806 10:58384051-58384073 CGCCCCCAGCCCCAAAGGTGAGG - Intergenic
1069636718 10:69929601-69929623 CCCCACCTGACCCAAAGAAGGGG + Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070783395 10:79150047-79150069 CCCCACCCAGCCCAGGGGAGAGG - Intronic
1073147061 10:101288008-101288030 CCACTCCCACCCCAAGGGAGGGG + Intergenic
1073212852 10:101818648-101818670 CATTACCCGCCCCGAAGGAGGGG + Intergenic
1076152936 10:128177999-128178021 CCCCTCCCCCCACAAAGCAGCGG - Intergenic
1077110018 11:858214-858236 CCCCACCCACCCCTTTGGAGAGG - Intronic
1077421555 11:2452500-2452522 CCCCACCCTGCCCCAAAGAGGGG + Intronic
1077599301 11:3562584-3562606 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
1077897619 11:6465484-6465506 CCTCACCCTCCCCACAGGGGAGG + Intronic
1078179891 11:9003137-9003159 CCAGCCCCGCCCCCAAGGAGTGG - Intronic
1080034820 11:27700266-27700288 CCCCGCCGGCCCCACAGCAGCGG + Intronic
1081691085 11:45079101-45079123 CCCCAACAGCCCCTAAGCAGGGG - Intergenic
1081774406 11:45667436-45667458 CCCCACCCCCACCCAGGGAGTGG + Intergenic
1081985560 11:47300453-47300475 CCCCGCCCGCCCCAAAGTGCTGG + Intronic
1084418335 11:69047630-69047652 CTCCCCCCTCCCCAAAAGAGGGG + Intergenic
1084657733 11:70528874-70528896 CCACACCCGCCTCTCAGGAGGGG + Intronic
1084784861 11:71436336-71436358 ACCCACCTTCCCCAAAGAAGAGG + Intronic
1084817546 11:71658109-71658131 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
1090189905 11:124760808-124760830 CCCCACCCCCCACAAGGAAGGGG + Intronic
1090299921 11:125626289-125626311 CCCCACCCGTCCCAAAGGCCGGG - Intronic
1091689416 12:2585480-2585502 CTCCACCCGCCACCAAGGTGAGG + Exonic
1092181900 12:6451917-6451939 CCCCACCTGTCCCAAAAAAGTGG - Intronic
1095803862 12:46296808-46296830 CCCCAGCCCCTCCAGAGGAGTGG - Intergenic
1096230695 12:49895326-49895348 CCCCATCCCCCCCAATGGAGTGG + Intronic
1099478629 12:83140094-83140116 CCACACCTGCCCCCAAGCAGAGG - Intergenic
1100437104 12:94581785-94581807 CTCCACCAGCCCCAAACGACTGG + Exonic
1101941477 12:109102320-109102342 CCGCGCCCGGCCCAAAGCAGTGG - Intronic
1103486900 12:121289073-121289095 CCCCACCCCAACCAAAAGAGCGG + Intronic
1104383003 12:128324322-128324344 CTCCACCGGCCTAAAAGGAGAGG + Intronic
1107655831 13:42591395-42591417 CCTCACCCTCCCCAGAGGAGAGG - Intronic
1113516625 13:110907740-110907762 CCCTATCCTCCCCAAAAGAGAGG + Intronic
1113855955 13:113445595-113445617 CCCTCCCCTCCCCAAAGGTGGGG - Intronic
1114418071 14:22557308-22557330 CACATCCCCCCCCAAAGGAGAGG + Intronic
1115343653 14:32318900-32318922 CCCCACCCCCACCCAAAGAGGGG - Intergenic
1115500062 14:34041774-34041796 CCCCAACTCCCCCAAAGGAGCGG + Intronic
1118749377 14:68795314-68795336 CCCCACCCCCCCCAAAAAAGAGG + Intronic
1119193746 14:72702174-72702196 CCCCACCCACCCCAACGGCCTGG + Intronic
1119261530 14:73240794-73240816 CCCCCTCCTCCCCAAAGGTGGGG - Intronic
1121713184 14:96054048-96054070 CACCACCCTCCCCAACTGAGGGG - Intronic
1122770554 14:104095837-104095859 CACCACCTGCCCCGCAGGAGGGG + Intronic
1122836751 14:104434374-104434396 CCCCACCTGCTCCAAAGGTGTGG - Intergenic
1122940279 14:104978137-104978159 GCCCACCCGCCCCAGGGGAGCGG + Intronic
1123008423 14:105335509-105335531 CCCCACCTGCCCCAGAATAGGGG - Intronic
1123646066 15:22438174-22438196 CCCCACCCACCCTAAGAGAGGGG + Intergenic
1124299954 15:28533145-28533167 CCCCACCCACCCTAAGAGAGGGG + Intergenic
1124350349 15:28950736-28950758 CCCCACCCCCCATGAAGGAGTGG - Intronic
1125013352 15:34905087-34905109 CCCCACCCCCCCCAAAAAAGAGG - Intronic
1127991620 15:64122990-64123012 CCCCCCCGGCACCAATGGAGGGG + Intronic
1128144831 15:65327224-65327246 CCGCACCCTTCCCAAGGGAGAGG + Exonic
1129105541 15:73304795-73304817 CCCCACCCGCCCCAATTCTGTGG - Exonic
1129281661 15:74489915-74489937 CCTCACCCTCCCCAAATGACAGG - Intergenic
1130810616 15:87374271-87374293 CCCCACCCCTCAAAAAGGAGAGG + Intergenic
1132642603 16:984644-984666 CCCCACCCGCCCCACAGAAGGGG + Intronic
1132745898 16:1436212-1436234 CCCCACCTTCCCCACTGGAGGGG - Intronic
1133372907 16:5258998-5259020 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
1134257869 16:12626498-12626520 CCCCACCCCCCCCCAAAAAGGGG + Intergenic
1136500927 16:30669387-30669409 CCTCACCCGCCTCATAGAAGCGG - Exonic
1137447314 16:48539708-48539730 CACCACGAGCCCCAAAGGTGGGG + Exonic
1139522511 16:67492386-67492408 CCGCGCCCGGCCCAAAGGTGAGG + Intergenic
1140221465 16:73047652-73047674 CCCCACACGCCCCAAGAGAATGG + Intronic
1141096038 16:81163819-81163841 CCCCACCCGCCCCACACGCCAGG - Intergenic
1141577149 16:84971387-84971409 CCCCCCAGACCCCAAAGGAGAGG + Intergenic
1141702952 16:85650795-85650817 TCCCACCCGGCCCAAAGCTGTGG + Intronic
1142851304 17:2706117-2706139 CCCCACCCGGCTCTCAGGAGCGG + Intronic
1143173326 17:4942747-4942769 CCCCACCCCACCTAAAGGATTGG - Intronic
1144640145 17:16932395-16932417 CCCCACCTTCCTCAAGGGAGTGG + Intronic
1144649505 17:16998284-16998306 CCCCACCCCACCCTAAGGAATGG - Intergenic
1146272575 17:31493978-31494000 CCTCAGCCACCCCAAAGCAGGGG - Intronic
1146902931 17:36600074-36600096 CCCAACCAGCCCCAGAGGAGGGG + Intronic
1147326670 17:39672978-39673000 CCCCAATCTCCCCTAAGGAGTGG + Intronic
1147342832 17:39764802-39764824 CCTCCCCCTCCCCACAGGAGAGG - Intergenic
1147382044 17:40062014-40062036 CCTAACCCAACCCAAAGGAGAGG - Intronic
1147492907 17:40887654-40887676 CCCCACCCTCCCAAAATGATGGG + Intergenic
1148665331 17:49370605-49370627 CCCCACCCCCCCCAAAAAAAAGG + Intergenic
1148733845 17:49853439-49853461 CCCCACATGCCCCAACAGAGGGG - Intergenic
1149296460 17:55265849-55265871 TCCCACCCGCGCCGCAGGAGCGG - Intronic
1151232041 17:72691991-72692013 CCCCACCTACCTCAAAGTAGTGG + Intronic
1151388588 17:73770618-73770640 CCCATCCCACCCCAAGGGAGTGG + Intergenic
1152185352 17:78852870-78852892 CCCCTCCCGCCGGACAGGAGAGG + Intergenic
1152299102 17:79485086-79485108 TCCCACCAGCCCCAAAGCAGAGG + Intronic
1152379188 17:79933696-79933718 CCCAGCCGGCCCCAAAGGTGTGG + Exonic
1152711094 17:81870924-81870946 CCCCCCGCGTCCCCAAGGAGGGG + Intronic
1153051375 18:905773-905795 CCCAACCCGGCCCACAGGATGGG + Intronic
1156495029 18:37520022-37520044 CCCCAGTCTCCCCCAAGGAGAGG - Intronic
1157507019 18:48233914-48233936 CCCAACCACCCTCAAAGGAGAGG - Intronic
1161197258 19:2993771-2993793 CCCCACCCGCCCCACCGGCGCGG + Intronic
1161438297 19:4277153-4277175 CCCGACCCTACCCCAAGGAGGGG - Intergenic
1161570891 19:5030412-5030434 GCCCACCTGCCCCACAGGACTGG - Intronic
1161861056 19:6798661-6798683 CCCCCCCCACCCAAAAGAAGGGG + Intronic
1161962193 19:7529042-7529064 CCCCAGGCCCCCCAAAGGAAGGG + Intronic
1161969875 19:7572094-7572116 CCCCCCCCGCCTCAAAACAGTGG - Intergenic
1162070304 19:8148930-8148952 CCCCACCCGACCCGAGGCAGGGG - Intronic
1163105934 19:15123089-15123111 CCCCACTGGCCCCCAAGGACTGG + Intronic
1163586045 19:18164203-18164225 CCCAACCAGCCTCACAGGAGTGG + Intronic
1163678978 19:18669774-18669796 CTCCACCCACCCCAAACCAGGGG - Exonic
1164562214 19:29300109-29300131 CCCCAGCCCCCGCCAAGGAGTGG - Intergenic
1165585868 19:36915587-36915609 CCCCACCCCCCCAAAAAAAGAGG - Intronic
1166379664 19:42349389-42349411 CCCCACCCCCTCCTAAGAAGAGG - Intronic
1166594226 19:44030879-44030901 CCCCCCATGCCCCAAAGGAGTGG + Intronic
1166930970 19:46301105-46301127 CCCCACCAGCCAGGAAGGAGGGG + Intronic
1167550135 19:50154719-50154741 CCCCACCCGCCCCAGTCGACCGG - Exonic
1167577143 19:50323178-50323200 CCCCACCCGCACCACGGCAGCGG - Exonic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927092512 2:19722806-19722828 CCCCACCAGCCCTGTAGGAGCGG + Intergenic
927240298 2:20915075-20915097 CCTCACCCACCCACAAGGAGAGG - Intergenic
927998990 2:27506869-27506891 TCCCACCAGCACCAAAGGTGTGG - Exonic
928177988 2:29047909-29047931 CCCCACCCCCACCAAAGGCTGGG - Intronic
931940890 2:67251065-67251087 ACCCACTCCTCCCAAAGGAGAGG - Intergenic
933805844 2:85997635-85997657 CCCAACCCTACCCAAAGTAGGGG + Intergenic
933970818 2:87468607-87468629 CCCCACCCACCCAACAGGGGAGG - Intergenic
934035874 2:88088132-88088154 CCCCACCCTCCCCAAGTGGGAGG - Intronic
934664807 2:96163038-96163060 CCCCAGCAGCCCCAACTGAGGGG - Intergenic
935038550 2:99403221-99403243 CCCCTCCTGCCCCAAGTGAGAGG + Intronic
936322912 2:111481589-111481611 CCCCACCCACCCAACAGGGGAGG + Intergenic
937362822 2:121240816-121240838 CCCCACGGCCCGCAAAGGAGTGG - Intronic
938096032 2:128464730-128464752 CCACACCCTCCCCAAGGCAGGGG + Intergenic
938108973 2:128551715-128551737 CCCCACCCAGCCCAAGGGTGGGG + Intergenic
943982850 2:194577171-194577193 CCCCACCCCCCCAAAAATAGAGG + Intergenic
947210965 2:227708093-227708115 CCCCACGTACCCCAAAGAAGGGG - Intronic
947418558 2:229921943-229921965 CCCCACCCCCCCCAGCGGCGCGG + Exonic
1171036361 20:21715294-21715316 GCCCACCAGCCCTAATGGAGGGG + Exonic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1173946964 20:46959330-46959352 CCCCACCCCCAACAAAGGAATGG - Intronic
1175157206 20:56979176-56979198 CCCCACGCGCCCCACAAGGGAGG - Intergenic
1175697313 20:61112151-61112173 CCCCCTCCGCCCCAGAGGTGGGG - Intergenic
1176034228 20:63028544-63028566 CCCCACCCGCCCCGGGGGAAAGG - Intergenic
1176213696 20:63938618-63938640 CCCCACCCGACCCTGAGCAGCGG - Intergenic
1176556573 21:8256683-8256705 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1176575512 21:8439725-8439747 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1178529255 21:33361539-33361561 CCCTATCCGCCCCCAGGGAGAGG + Intergenic
1181322950 22:22022718-22022740 CCCCACCCTCTGCAGAGGAGGGG - Intergenic
1181687850 22:24541947-24541969 CCCCAACCTCCCCAAAAAAGAGG + Intronic
1183120780 22:35728581-35728603 CCCCTCCCGCCCCAGGGCAGTGG - Intronic
1183192524 22:36330908-36330930 CCCCACCCTCACCAAGAGAGGGG - Intronic
1183432570 22:37774592-37774614 CCCCACCCTTCCTAAAGCAGCGG + Exonic
1183675501 22:39296981-39297003 CCCCACCAGCCCCAAGGGAAGGG - Intergenic
1183874400 22:40766696-40766718 CCCCACCCACCACAAAAAAGTGG - Intergenic
1185203151 22:49520888-49520910 TCCCACCCGCACTCAAGGAGAGG + Intronic
1203253562 22_KI270733v1_random:128780-128802 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203261617 22_KI270733v1_random:173858-173880 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
949765333 3:7520127-7520149 CCCCACCCAGATCAAAGGAGAGG + Intronic
950098396 3:10343261-10343283 CCCCTCCAGCCCCCGAGGAGGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954385572 3:50242197-50242219 CCCCACCCCACCCACAGCAGAGG + Intronic
954764000 3:52897664-52897686 CCCCACCCGCCCCCGAGGGGCGG + Intergenic
955574679 3:60347666-60347688 CCCCCCCCCCCCCAAACCAGTGG - Intronic
957070148 3:75561434-75561456 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
957448112 3:80340543-80340565 CCCCACCCACACCTAAGGGGTGG - Intergenic
960529988 3:118753463-118753485 CCCCACCTGGCCCAAAGAAGGGG - Intergenic
961283963 3:125785297-125785319 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
963315192 3:143751544-143751566 CCCCAGCTGACCCCAAGGAGTGG - Intronic
968225159 3:196968648-196968670 CCCCAGCGGCTCCAGAGGAGCGG - Intronic
968870893 4:3241681-3241703 CCCCAGCTGCCACATAGGAGAGG - Exonic
969013739 4:4088891-4088913 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
969098945 4:4754752-4754774 CCCCGCCGGCCCCAAAGGGAAGG + Intergenic
969799407 4:9551038-9551060 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
970235142 4:13951121-13951143 CCACCCCCACCCCAAAGCAGAGG + Intergenic
972879320 4:43404909-43404931 CACCACCCTCCCCAATGGAATGG - Intergenic
975616958 4:76256351-76256373 CCCAACTGGCCCCAAAGAAGAGG + Exonic
981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG + Intergenic
984438469 4:179734644-179734666 CCCCACCCCCCCCAAAAAAAAGG - Intergenic
985289931 4:188376919-188376941 CCCCACCAGTGCCAAGGGAGGGG + Intergenic
986760457 5:10875469-10875491 CCCCACACGCCCCAAATGCCTGG + Intergenic
988264795 5:28934190-28934212 GCCCCCCCGCCCCGGAGGAGAGG + Intergenic
992551794 5:77866415-77866437 CCCACTCAGCCCCAAAGGAGTGG + Intronic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
997518384 5:134506534-134506556 CCCCACCCTGCCCAGGGGAGAGG - Intergenic
998316794 5:141189635-141189657 CACCTCCCGCCCCATAGGGGTGG + Exonic
1001647846 5:173295432-173295454 CCCCCCCCACCCACAAGGAGGGG - Intergenic
1002433973 5:179220219-179220241 CCCCACGGGTCCCAAAGGAAGGG + Intronic
1002625783 5:180528002-180528024 CCCCACCCTCCCCAAATCTGTGG + Intronic
1003399606 6:5781094-5781116 CCCCTCCTGCCCCAGAGGAGAGG - Intergenic
1003817780 6:9861675-9861697 TCCCACTGGCCCCAAGGGAGGGG - Intronic
1005958829 6:30682607-30682629 CCCCACCCCCACCCAAGCAGCGG + Intronic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1007781366 6:44256826-44256848 CCCCACCTGCCCCTAGGGAGGGG + Exonic
1013346363 6:109264294-109264316 CCCCACAAACCCCCAAGGAGGGG + Intergenic
1015535200 6:134260370-134260392 CCCCACCCCCCCCAAAAAAAGGG + Intronic
1018736525 6:166690640-166690662 CCCCTCCTGCCCCCAGGGAGCGG - Intronic
1019345739 7:529894-529916 CCACCCCCGCCCCGAGGGAGAGG + Intergenic
1019445047 7:1066761-1066783 CCCCACATGCCCCAAAGGAGAGG + Intronic
1019593176 7:1845931-1845953 CTCCACGCTCCCCAAGGGAGGGG + Intronic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1022514250 7:30965386-30965408 CCCCACCCACCCCTGAGGGGAGG - Intronic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1025610261 7:63071486-63071508 CCCCACCCTCCCCCAAAGTGAGG + Intergenic
1025709186 7:63891566-63891588 CCCCACCCTCCCCAAAGTGAAGG + Intergenic
1026911218 7:74093016-74093038 CCCCACCCGCACCAAAGCCCAGG + Intronic
1026947830 7:74327704-74327726 CCCCACCAGCCACAGAAGAGCGG - Intronic
1026977658 7:74508212-74508234 CCCCACCCACCCAAGAGGAGGGG + Intronic
1029072390 7:97910516-97910538 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
1029171059 7:98629201-98629223 CCCCGCCTTCCCCAAAGCAGAGG + Exonic
1031007820 7:116494800-116494822 CCCCACCCCCCCCAATACAGAGG - Intronic
1034962717 7:155372632-155372654 CCCCACGCGGCCCTAAGGCGGGG + Intergenic
1035311267 7:157970523-157970545 ACCCACCCGCACCAATGGTGAGG - Intronic
1036888963 8:12582545-12582567 CCCCTTCCTCCCCACAGGAGGGG + Intergenic
1037587471 8:20287997-20288019 CCCCATCCCCAGCAAAGGAGTGG - Intronic
1037981120 8:23255110-23255132 CCCCATCCTCCCCAAAGTAGCGG - Intronic
1038532756 8:28331742-28331764 CTCCACCCACCCCAGTGGAGTGG + Intronic
1038692294 8:29774330-29774352 CCACTCCCGCCCGAGAGGAGAGG + Intergenic
1044319980 8:90791317-90791339 CCCGACCTTCCCCAAAGGCGGGG - Intronic
1044322129 8:90814422-90814444 CCCAACCCACACCCAAGGAGAGG + Intronic
1044449903 8:92322591-92322613 CCCCACCAACCTCTAAGGAGGGG - Intergenic
1044591263 8:93916676-93916698 CCCCCCCCGCCCCCAGCGAGTGG - Intronic
1044703628 8:94987291-94987313 CCCAACCCCCTCCAAAGCAGAGG + Intronic
1045371665 8:101530167-101530189 CCCCTCCTGCACCAAAGGTGGGG + Intronic
1046636879 8:116680180-116680202 CCCCACCCTCCCGGAAGGGGCGG - Intronic
1047166865 8:122449125-122449147 CCCCACCCCACTCACAGGAGTGG + Intergenic
1049341055 8:142112864-142112886 CCACACCCACCGCAAAGGATGGG + Intergenic
1049442927 8:142617404-142617426 CCCCACCTGCCTGAGAGGAGGGG + Intergenic
1049618276 8:143585960-143585982 CCCAGCCGGCCCCACAGGAGCGG + Intronic
1049672450 8:143875993-143876015 GCCCACCCGCCCCAGAGCTGTGG - Intronic
1049816835 8:144607565-144607587 CCCACCCCGCCCCCCAGGAGAGG + Intergenic
1049830530 8:144698879-144698901 CCCCAACCCCCCCAAGGGAGGGG - Intergenic
1050683696 9:8143166-8143188 CCCCACCAGCAACACAGGAGAGG + Intergenic
1051478069 9:17530660-17530682 CCTCACCAGCCCCACAGGACTGG + Intergenic
1057488967 9:95507525-95507547 CCCGACCAGGCCCTAAGGAGAGG + Intronic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1060796282 9:126514713-126514735 CTCCACCCGCCCCTAAAGGGTGG + Intergenic
1061131600 9:128711596-128711618 CCCCACCCCCCCCAAAAAAAAGG - Intronic
1061180796 9:129023931-129023953 CGCCACCCCCCTCAAAGGACTGG - Intronic
1061281099 9:129597932-129597954 CCCCACCCATCCCACCGGAGAGG + Intergenic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1062436506 9:136548745-136548767 CCACAGCAGCCGCAAAGGAGGGG - Intergenic
1203469963 Un_GL000220v1:111927-111949 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203477784 Un_GL000220v1:155899-155921 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1186705784 X:12138403-12138425 CCCCACCCGCCCGGGGGGAGGGG - Intergenic
1187068309 X:15863023-15863045 CCCCACCCCCCCCAAAAAAAAGG + Intergenic
1190054829 X:47175405-47175427 CCCCACCAGCCCCGGGGGAGTGG - Intronic
1198043437 X:132876643-132876665 CCCCTCCCACCATAAAGGAGTGG - Intronic
1199484445 X:148332988-148333010 CCCCACCCACCCCATAAGGGTGG + Intergenic
1199615337 X:149651379-149651401 CTCCACCGGCCCCAGAGCAGAGG - Intergenic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic