ID: 1186222212

View in Genome Browser
Species Human (GRCh38)
Location X:7362209-7362231
Sequence CTGGGCTACCTGGTTTATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186222207_1186222212 11 Left 1186222207 X:7362175-7362197 CCTGCTTCAATATCTGACATTGG No data
Right 1186222212 X:7362209-7362231 CTGGGCTACCTGGTTTATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186222212 Original CRISPR CTGGGCTACCTGGTTTATGA CGG Intergenic
No off target data available for this crispr