ID: 1186225510

View in Genome Browser
Species Human (GRCh38)
Location X:7395156-7395178
Sequence CTGTGTGTCTAGCAGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186225507_1186225510 12 Left 1186225507 X:7395121-7395143 CCTCATGAATGCACCAGGCTTCG No data
Right 1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG No data
1186225508_1186225510 -1 Left 1186225508 X:7395134-7395156 CCAGGCTTCGTCTTGCCAGAAGC No data
Right 1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186225510 Original CRISPR CTGTGTGTCTAGCAGTAGAG AGG Intergenic
No off target data available for this crispr