ID: 1186227405

View in Genome Browser
Species Human (GRCh38)
Location X:7414629-7414651
Sequence ATGCTTGTATAAATGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186227403_1186227405 14 Left 1186227403 X:7414592-7414614 CCAAGAATGTTATCAGAGAAATA No data
Right 1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186227405 Original CRISPR ATGCTTGTATAAATGAAACA TGG Intergenic
No off target data available for this crispr