ID: 1186230621

View in Genome Browser
Species Human (GRCh38)
Location X:7449836-7449858
Sequence CCTTCCAGGCATACCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186230612_1186230621 21 Left 1186230612 X:7449792-7449814 CCTAACATCTTGGGTGTTTTGGT No data
Right 1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186230621 Original CRISPR CCTTCCAGGCATACCCAGCC TGG Intergenic
No off target data available for this crispr