ID: 1186234789

View in Genome Browser
Species Human (GRCh38)
Location X:7496056-7496078
Sequence CGTAAGCACAAAGGTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186234785_1186234789 12 Left 1186234785 X:7496021-7496043 CCGAAAAGGGTGGATTTGGTGAG No data
Right 1186234789 X:7496056-7496078 CGTAAGCACAAAGGTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186234789 Original CRISPR CGTAAGCACAAAGGTTTTCC TGG Intergenic