ID: 1186239599

View in Genome Browser
Species Human (GRCh38)
Location X:7552331-7552353
Sequence ACCAAGAATGTCTCCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186239599_1186239601 -1 Left 1186239599 X:7552331-7552353 CCATATCTGGAGACATTCTTGGT No data
Right 1186239601 X:7552353-7552375 TTGTCACTATTAGGAAGAGCTGG No data
1186239599_1186239600 -10 Left 1186239599 X:7552331-7552353 CCATATCTGGAGACATTCTTGGT No data
Right 1186239600 X:7552344-7552366 CATTCTTGGTTGTCACTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186239599 Original CRISPR ACCAAGAATGTCTCCAGATA TGG (reversed) Intergenic