ID: 1186239599 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:7552331-7552353 |
Sequence | ACCAAGAATGTCTCCAGATA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1186239599_1186239601 | -1 | Left | 1186239599 | X:7552331-7552353 | CCATATCTGGAGACATTCTTGGT | No data | ||
Right | 1186239601 | X:7552353-7552375 | TTGTCACTATTAGGAAGAGCTGG | No data | ||||
1186239599_1186239600 | -10 | Left | 1186239599 | X:7552331-7552353 | CCATATCTGGAGACATTCTTGGT | No data | ||
Right | 1186239600 | X:7552344-7552366 | CATTCTTGGTTGTCACTATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1186239599 | Original CRISPR | ACCAAGAATGTCTCCAGATA TGG (reversed) | Intergenic | ||