ID: 1186239600 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:7552344-7552366 |
| Sequence | CATTCTTGGTTGTCACTATT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186239599_1186239600 | -10 | Left | 1186239599 | X:7552331-7552353 | CCATATCTGGAGACATTCTTGGT | No data | ||
| Right | 1186239600 | X:7552344-7552366 | CATTCTTGGTTGTCACTATTAGG | No data | ||||
| 1186239596_1186239600 | 5 | Left | 1186239596 | X:7552316-7552338 | CCAGGAAACATTTGGCCATATCT | No data | ||
| Right | 1186239600 | X:7552344-7552366 | CATTCTTGGTTGTCACTATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186239600 | Original CRISPR | CATTCTTGGTTGTCACTATT AGG | Intergenic | ||