ID: 1186239601

View in Genome Browser
Species Human (GRCh38)
Location X:7552353-7552375
Sequence TTGTCACTATTAGGAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186239599_1186239601 -1 Left 1186239599 X:7552331-7552353 CCATATCTGGAGACATTCTTGGT No data
Right 1186239601 X:7552353-7552375 TTGTCACTATTAGGAAGAGCTGG No data
1186239596_1186239601 14 Left 1186239596 X:7552316-7552338 CCAGGAAACATTTGGCCATATCT No data
Right 1186239601 X:7552353-7552375 TTGTCACTATTAGGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186239601 Original CRISPR TTGTCACTATTAGGAAGAGC TGG Intergenic
No off target data available for this crispr