ID: 1186241114

View in Genome Browser
Species Human (GRCh38)
Location X:7567470-7567492
Sequence GGTCAGTCTTTGTACTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241114_1186241121 25 Left 1186241114 X:7567470-7567492 CCTGAAAAGTACAAAGACTGACC No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241114_1186241120 24 Left 1186241114 X:7567470-7567492 CCTGAAAAGTACAAAGACTGACC No data
Right 1186241120 X:7567517-7567539 CTGCCTGTCAGCTTTCAAACTGG No data
1186241114_1186241122 26 Left 1186241114 X:7567470-7567492 CCTGAAAAGTACAAAGACTGACC No data
Right 1186241122 X:7567519-7567541 GCCTGTCAGCTTTCAAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241114 Original CRISPR GGTCAGTCTTTGTACTTTTC AGG (reversed) Intergenic