ID: 1186241115

View in Genome Browser
Species Human (GRCh38)
Location X:7567491-7567513
Sequence AATTCTCTGTCGCTCGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241115_1186241120 3 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241120 X:7567517-7567539 CTGCCTGTCAGCTTTCAAACTGG No data
1186241115_1186241121 4 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241115_1186241122 5 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241122 X:7567519-7567541 GCCTGTCAGCTTTCAAACTGGGG No data
1186241115_1186241124 21 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241115 Original CRISPR AATTCTCTGTCGCTCGGGGA AGG (reversed) Intergenic