ID: 1186241116

View in Genome Browser
Species Human (GRCh38)
Location X:7567495-7567517
Sequence GGAGAATTCTCTGTCGCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241116_1186241124 17 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241116_1186241122 1 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241122 X:7567519-7567541 GCCTGTCAGCTTTCAAACTGGGG No data
1186241116_1186241120 -1 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241120 X:7567517-7567539 CTGCCTGTCAGCTTTCAAACTGG No data
1186241116_1186241121 0 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241116 Original CRISPR GGAGAATTCTCTGTCGCTCG GGG (reversed) Intergenic