ID: 1186241118

View in Genome Browser
Species Human (GRCh38)
Location X:7567497-7567519
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241118_1186241121 -2 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241118_1186241122 -1 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241122 X:7567519-7567541 GCCTGTCAGCTTTCAAACTGGGG No data
1186241118_1186241120 -3 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241120 X:7567517-7567539 CTGCCTGTCAGCTTTCAAACTGG No data
1186241118_1186241124 15 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241118 Original CRISPR CAGGAGAATTCTCTGTCGCT CGG (reversed) Intergenic