ID: 1186241121

View in Genome Browser
Species Human (GRCh38)
Location X:7567518-7567540
Sequence TGCCTGTCAGCTTTCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241116_1186241121 0 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241115_1186241121 4 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241114_1186241121 25 Left 1186241114 X:7567470-7567492 CCTGAAAAGTACAAAGACTGACC No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241118_1186241121 -2 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data
1186241117_1186241121 -1 Left 1186241117 X:7567496-7567518 CCCGAGCGACAGAGAATTCTCCT No data
Right 1186241121 X:7567518-7567540 TGCCTGTCAGCTTTCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241121 Original CRISPR TGCCTGTCAGCTTTCAAACT GGG Intergenic