ID: 1186241123

View in Genome Browser
Species Human (GRCh38)
Location X:7567520-7567542
Sequence GCCCCAGTTTGAAAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241123_1186241124 -8 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241123_1186241128 29 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241128 X:7567572-7567594 GCCAGCCTTAGGACTTGTATTGG No data
1186241123_1186241130 30 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241130 X:7567573-7567595 CCAGCCTTAGGACTTGTATTGGG No data
1186241123_1186241126 18 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241126 X:7567561-7567583 TGCAGCTGCCTGCCAGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241123 Original CRISPR GCCCCAGTTTGAAAGCTGAC AGG (reversed) Intergenic