ID: 1186241124

View in Genome Browser
Species Human (GRCh38)
Location X:7567535-7567557
Sequence ACTGGGGCATAGACTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241123_1186241124 -8 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241117_1186241124 16 Left 1186241117 X:7567496-7567518 CCCGAGCGACAGAGAATTCTCCT No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241116_1186241124 17 Left 1186241116 X:7567495-7567517 CCCCGAGCGACAGAGAATTCTCC No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241118_1186241124 15 Left 1186241118 X:7567497-7567519 CCGAGCGACAGAGAATTCTCCTG No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241119_1186241124 -4 Left 1186241119 X:7567516-7567538 CCTGCCTGTCAGCTTTCAAACTG No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data
1186241115_1186241124 21 Left 1186241115 X:7567491-7567513 CCTTCCCCGAGCGACAGAGAATT No data
Right 1186241124 X:7567535-7567557 ACTGGGGCATAGACTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241124 Original CRISPR ACTGGGGCATAGACTCTTCC TGG Intergenic