ID: 1186241126

View in Genome Browser
Species Human (GRCh38)
Location X:7567561-7567583
Sequence TGCAGCTGCCTGCCAGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241119_1186241126 22 Left 1186241119 X:7567516-7567538 CCTGCCTGTCAGCTTTCAAACTG No data
Right 1186241126 X:7567561-7567583 TGCAGCTGCCTGCCAGCCTTAGG No data
1186241123_1186241126 18 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241126 X:7567561-7567583 TGCAGCTGCCTGCCAGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241126 Original CRISPR TGCAGCTGCCTGCCAGCCTT AGG Intergenic