ID: 1186241128 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:7567572-7567594 |
Sequence | GCCAGCCTTAGGACTTGTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1186241125_1186241128 | -4 | Left | 1186241125 | X:7567553-7567575 | CCTGGTTCTGCAGCTGCCTGCCA | No data | ||
Right | 1186241128 | X:7567572-7567594 | GCCAGCCTTAGGACTTGTATTGG | No data | ||||
1186241123_1186241128 | 29 | Left | 1186241123 | X:7567520-7567542 | CCTGTCAGCTTTCAAACTGGGGC | No data | ||
Right | 1186241128 | X:7567572-7567594 | GCCAGCCTTAGGACTTGTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1186241128 | Original CRISPR | GCCAGCCTTAGGACTTGTAT TGG | Intergenic | ||