ID: 1186241128

View in Genome Browser
Species Human (GRCh38)
Location X:7567572-7567594
Sequence GCCAGCCTTAGGACTTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186241125_1186241128 -4 Left 1186241125 X:7567553-7567575 CCTGGTTCTGCAGCTGCCTGCCA No data
Right 1186241128 X:7567572-7567594 GCCAGCCTTAGGACTTGTATTGG No data
1186241123_1186241128 29 Left 1186241123 X:7567520-7567542 CCTGTCAGCTTTCAAACTGGGGC No data
Right 1186241128 X:7567572-7567594 GCCAGCCTTAGGACTTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186241128 Original CRISPR GCCAGCCTTAGGACTTGTAT TGG Intergenic