ID: 1186242290

View in Genome Browser
Species Human (GRCh38)
Location X:7582438-7582460
Sequence AAAGGATTTGCAAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186242286_1186242290 23 Left 1186242286 X:7582392-7582414 CCACATTTTGGCTACTGCTTATG No data
Right 1186242290 X:7582438-7582460 AAAGGATTTGCAAAGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186242290 Original CRISPR AAAGGATTTGCAAAGTCTGA TGG Intergenic
No off target data available for this crispr