ID: 1186250288

View in Genome Browser
Species Human (GRCh38)
Location X:7658633-7658655
Sequence GTATTTCACTCTGACAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186250288_1186250290 25 Left 1186250288 X:7658633-7658655 CCAGGTCTGTCAGAGTGAAATAC No data
Right 1186250290 X:7658681-7658703 TTATCTGCTTAGTTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186250288 Original CRISPR GTATTTCACTCTGACAGACC TGG (reversed) Intergenic
No off target data available for this crispr