ID: 1186250290

View in Genome Browser
Species Human (GRCh38)
Location X:7658681-7658703
Sequence TTATCTGCTTAGTTTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186250288_1186250290 25 Left 1186250288 X:7658633-7658655 CCAGGTCTGTCAGAGTGAAATAC No data
Right 1186250290 X:7658681-7658703 TTATCTGCTTAGTTTAAAAATGG No data
1186250289_1186250290 3 Left 1186250289 X:7658655-7658677 CCTTTGAAAATAGAACTGACTAT No data
Right 1186250290 X:7658681-7658703 TTATCTGCTTAGTTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186250290 Original CRISPR TTATCTGCTTAGTTTAAAAA TGG Intergenic
No off target data available for this crispr