ID: 1186250510

View in Genome Browser
Species Human (GRCh38)
Location X:7660762-7660784
Sequence CAATTGCATCAAATATACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186250505_1186250510 23 Left 1186250505 X:7660716-7660738 CCACGGAAAGCAGCTAAGAAGAG No data
Right 1186250510 X:7660762-7660784 CAATTGCATCAAATATACCAGGG No data
1186250507_1186250510 -4 Left 1186250507 X:7660743-7660765 CCAAGGATGCCATGTACAGCAAT No data
Right 1186250510 X:7660762-7660784 CAATTGCATCAAATATACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186250510 Original CRISPR CAATTGCATCAAATATACCA GGG Intergenic
No off target data available for this crispr