ID: 1186264184

View in Genome Browser
Species Human (GRCh38)
Location X:7813922-7813944
Sequence TCCAAAACTCCTCAGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186264184_1186264197 24 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264197 X:7813969-7813991 TGGGTAGGGGGCTGAGGAGCTGG No data
1186264184_1186264196 18 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264196 X:7813963-7813985 TTTTGGTGGGTAGGGGGCTGAGG No data
1186264184_1186264199 26 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264199 X:7813971-7813993 GGTAGGGGGCTGAGGAGCTGGGG No data
1186264184_1186264193 10 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264193 X:7813955-7813977 TAAGGGAATTTTGGTGGGTAGGG No data
1186264184_1186264188 -7 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264188 X:7813938-7813960 TTTTGGACTGGAGTTTTTAAGGG No data
1186264184_1186264192 9 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264192 X:7813954-7813976 TTAAGGGAATTTTGGTGGGTAGG No data
1186264184_1186264187 -8 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264187 X:7813937-7813959 GTTTTGGACTGGAGTTTTTAAGG No data
1186264184_1186264190 4 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264190 X:7813949-7813971 AGTTTTTAAGGGAATTTTGGTGG No data
1186264184_1186264191 5 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG No data
1186264184_1186264194 11 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264194 X:7813956-7813978 AAGGGAATTTTGGTGGGTAGGGG No data
1186264184_1186264189 1 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264189 X:7813946-7813968 TGGAGTTTTTAAGGGAATTTTGG No data
1186264184_1186264200 27 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264200 X:7813972-7813994 GTAGGGGGCTGAGGAGCTGGGGG No data
1186264184_1186264195 12 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264195 X:7813957-7813979 AGGGAATTTTGGTGGGTAGGGGG No data
1186264184_1186264198 25 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264198 X:7813970-7813992 GGGTAGGGGGCTGAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186264184 Original CRISPR TCCAAAACTCCTCAGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr