ID: 1186264191

View in Genome Browser
Species Human (GRCh38)
Location X:7813950-7813972
Sequence GTTTTTAAGGGAATTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186264185_1186264191 2 Left 1186264185 X:7813925-7813947 CCTTTCTGAGGAGTTTTGGACTG No data
Right 1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG No data
1186264181_1186264191 13 Left 1186264181 X:7813914-7813936 CCTCAAACCCACCTTTCTGAGGA No data
Right 1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG No data
1186264182_1186264191 6 Left 1186264182 X:7813921-7813943 CCCACCTTTCTGAGGAGTTTTGG No data
Right 1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG No data
1186264184_1186264191 5 Left 1186264184 X:7813922-7813944 CCACCTTTCTGAGGAGTTTTGGA No data
Right 1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186264191 Original CRISPR GTTTTTAAGGGAATTTTGGT GGG Intergenic
No off target data available for this crispr