ID: 1186266904

View in Genome Browser
Species Human (GRCh38)
Location X:7842995-7843017
Sequence CAGGACATGGCGGATGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 6, 1: 0, 2: 0, 3: 8, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266904_1186266909 0 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64
1186266904_1186266910 18 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266910 X:7843036-7843058 TAAGGCCTTCCTTCCCGCCCAGG 0: 3
1: 3
2: 0
3: 18
4: 122
1186266904_1186266914 29 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266904_1186266911 19 Left 1186266904 X:7842995-7843017 CCGACTTCATCCGCCATGTCCTG 0: 6
1: 0
2: 0
3: 8
4: 190
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266904 Original CRISPR CAGGACATGGCGGATGAAGT CGG (reversed) Intronic