ID: 1186266906

View in Genome Browser
Species Human (GRCh38)
Location X:7843005-7843027
Sequence AAAGCACCATCAGGACATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 5, 1: 1, 2: 1, 3: 14, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266906_1186266917 23 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266917 X:7843051-7843073 CGCCCAGGGCGACCATTGGCTGG 0: 1
1: 2
2: 3
3: 4
4: 74
1186266906_1186266914 19 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266906_1186266911 9 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266906_1186266921 30 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87
1186266906_1186266910 8 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266910 X:7843036-7843058 TAAGGCCTTCCTTCCCGCCCAGG 0: 3
1: 3
2: 0
3: 18
4: 122
1186266906_1186266918 24 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266918 X:7843052-7843074 GCCCAGGGCGACCATTGGCTGGG 0: 1
1: 2
2: 3
3: 8
4: 131
1186266906_1186266909 -10 Left 1186266906 X:7843005-7843027 CCGCCATGTCCTGATGGTGCTTT 0: 5
1: 1
2: 1
3: 14
4: 231
Right 1186266909 X:7843018-7843040 ATGGTGCTTTGTGACGTATAAGG 0: 3
1: 3
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266906 Original CRISPR AAAGCACCATCAGGACATGG CGG (reversed) Intronic