ID: 1186266908

View in Genome Browser
Species Human (GRCh38)
Location X:7843014-7843036
Sequence ATACGTCACAAAGCACCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 3, 1: 3, 2: 0, 3: 4, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186266908_1186266918 15 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266918 X:7843052-7843074 GCCCAGGGCGACCATTGGCTGGG 0: 1
1: 2
2: 3
3: 8
4: 131
1186266908_1186266914 10 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG 0: 1
1: 2
2: 3
3: 2
4: 48
1186266908_1186266917 14 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266917 X:7843051-7843073 CGCCCAGGGCGACCATTGGCTGG 0: 1
1: 2
2: 3
3: 4
4: 74
1186266908_1186266911 0 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266911 X:7843037-7843059 AAGGCCTTCCTTCCCGCCCAGGG 0: 3
1: 3
2: 2
3: 15
4: 142
1186266908_1186266910 -1 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266910 X:7843036-7843058 TAAGGCCTTCCTTCCCGCCCAGG 0: 3
1: 3
2: 0
3: 18
4: 122
1186266908_1186266921 21 Left 1186266908 X:7843014-7843036 CCTGATGGTGCTTTGTGACGTAT 0: 3
1: 3
2: 0
3: 4
4: 79
Right 1186266921 X:7843058-7843080 GGCGACCATTGGCTGGGTAGTGG 0: 1
1: 5
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186266908 Original CRISPR ATACGTCACAAAGCACCATC AGG (reversed) Intronic